View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4601-Insertion-6 (Length: 174)
Name: NF4601-Insertion-6
Description: NF4601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4601-Insertion-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 8e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 8e-75
Query Start/End: Original strand, 8 - 169
Target Start/End: Complemental strand, 7353434 - 7353274
Alignment:
| Q |
8 |
agacgcttggattgaactgcagaaattctgcaaaccaaccatttcattgttggtactctaaatgtcaaacaaaagtgaacactgttagtatatattctaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353434 |
agacgcttggattgaactgcagaaattcttcaaaccaaccatttcattgttggtactctaaatgtcaaacaaaagtgaacactgttagtatatattctaa |
7353335 |
T |
|
| Q |
108 |
tttgcttattatattgtgactatagactctttgcaccaagctcatagtgggaacaaatctca |
169 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
7353334 |
tttgcttagtatattgtgactatagact-tttgcaccaagctcatattgggaacaaatctca |
7353274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 15493358 - 15493310
Alignment:
| Q |
38 |
caaaccaaccatttcattgttggtactctaaatgtcaaacaaaagtgaa |
86 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
15493358 |
caaaccaaccatttcattgttgctactctaaatgtcaaacaaaggtgaa |
15493310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University