View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4601_low_5 (Length: 339)
Name: NF4601_low_5
Description: NF4601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4601_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 48493372 - 48493151
Alignment:
| Q |
19 |
ggtttaatctgaggcgtcaatctgaggttaaaagggagatagaaatccatgagcgattagggatttgg-tgaattcaagaagtgtatgggttatacgcgt |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48493372 |
ggtttaatttgaggcgtcaatctgaggttaaaaggttgatataaatccatgagtgattagggatttgggtgaattcaagaagtgtatgggttatacgcgt |
48493273 |
T |
 |
| Q |
118 |
gaaagggaaagtttttatggatttcgattgttgtcagatgtaagggaaagcttttatggattttgattttgaaagggaaaattttgaatcttagaaattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493272 |
gaaagggaaagtttttatggatttcgattgttgtcatatgtaagggaaagcttttatggattttgattttgaaagggaaaattttgaatcttagaaattg |
48493173 |
T |
 |
| Q |
218 |
cagtgtgtatgaaagagaaagc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48493172 |
cagtgtgtatgaaagagaaagc |
48493151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 22168810 - 22168857
Alignment:
| Q |
165 |
aagcttttatggattttgattttgaaagggaaaattttgaatcttaga |
212 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
22168810 |
aagcttttatggatttcgatttttaaagggaaaattttgaatcttaga |
22168857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 44554240 - 44554461
Alignment:
| Q |
19 |
ggtttaatctgaggcgtcaatctgaggttaaaagggagatagaaatccatgagcgattagggatttgg-tgaattcaagaagtgtatgggttatacgcgt |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44554240 |
ggtttaatatgaggcgtcaatctgaggttaaaaggaagataaaaatccatgagagattagggatttgggtgaattcaagaagtgtatgggttatacgcgt |
44554339 |
T |
 |
| Q |
118 |
gaaagggaaagtttttatggatttcgattgttgtcagatgtaagggaaagcttttatggattttgattttgaaagggaaaattttgaatcttagaaattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44554340 |
gaaagggaaagtttttatggatttcgattgttgtcaaatgtaagggaaagcttttatgaattttgattttgaaagggaaaattttgaatcttagaaattg |
44554439 |
T |
 |
| Q |
218 |
cagtgtgtatgaaagagaaagc |
239 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
44554440 |
caatgtgtatgaaagagaaagc |
44554461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 2420382 - 2420335
Alignment:
| Q |
165 |
aagcttttatggattttgattttgaaagggaaaattttgaatcttaga |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2420382 |
aagcttttatggatttcgattttgaaagggaaaattttgaatcttaga |
2420335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 31872396 - 31872441
Alignment:
| Q |
165 |
aagcttttatggattttgattttgaaagggaaaattttgaatctta |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
31872396 |
aagcttttatggatttcgattttgaaagtgaaagttttgaatctta |
31872441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 2166604 - 2166557
Alignment:
| Q |
165 |
aagcttttatggattttgattttgaaagggaaaattttgaatcttaga |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
2166604 |
aagcttttatggatttcgattttgaaagggaacattttgaatcttaga |
2166557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University