View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4601_low_8 (Length: 246)
Name: NF4601_low_8
Description: NF4601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4601_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 25216047 - 25215820
Alignment:
| Q |
19 |
caaggatctcttgtgaaatctacattaccccggattatcgcttgtgcaatggcttcttcagtttctgtactcaaaaaacacacaaactttatgaaaaagg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25216047 |
caaggatctcttgtgaaatctacattaccccggataatcgcttgtgcaatggcttcttcagtttctgtactcaaaaaacacacaaactttatgaaaaagg |
25215948 |
T |
|
| Q |
119 |
aacatttacatgaatttttctcaacacgtgcgcgtacacatacatatatctatacaagagaaaatatcagaagggacgaacctgcccagaaaggtggaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25215947 |
aacatttacatgaatttttctcaacacgtgcgcgtacacatacatatatctatacaagataaaatatcaaaagggacgaacctgcccagaaaggtggaac |
25215848 |
T |
|
| Q |
219 |
tccacagagcaaaatataaagaataact |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25215847 |
tccacagagcaaaatataaagaataact |
25215820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University