View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4602-Insertion-16 (Length: 85)
Name: NF4602-Insertion-16
Description: NF4602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4602-Insertion-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 6e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 6e-37
Query Start/End: Original strand, 8 - 85
Target Start/End: Original strand, 51430653 - 51430730
Alignment:
| Q |
8 |
acaagagcatcttctttacccttggcaatgaaaataccctcatgtctatgaggttcaacaatgaccttgctacctccc |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51430653 |
acaagagcatcttctttacccttggcaatgaaaataccctcatgtctatgaggttcaacaatgaccttgctacctccc |
51430730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 1e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 7 - 84
Target Start/End: Complemental strand, 17128471 - 17128394
Alignment:
| Q |
7 |
aacaagagcatcttctttacccttggcaatgaaaataccctcatgtctatgaggttcaacaatgaccttgctacctcc |
84 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| || ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
17128471 |
aacaagagcatcttctttacccttagcaatgaaaataccttcgtgtctatgaggctcaacaacaaccttgctacctcc |
17128394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University