View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4602_high_10 (Length: 350)
Name: NF4602_high_10
Description: NF4602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4602_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 11 - 331
Target Start/End: Complemental strand, 40183663 - 40183356
Alignment:
| Q |
11 |
cagagagagaaaaaatcaatcacggtgagggtttacgacaaaaatttacgtatgacctactaatagaagaatttcatacttaaactcaaatcacaattcg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40183663 |
cagagagagaaaaaatcaatcacggtgagggtttacgacaaaaatttacgtatgacctactaatagaagaatttcatactcaaactcaaatcacaattcg |
40183564 |
T |
 |
| Q |
111 |
tacaatgagaaaatttgatcatctatgtcatacatatgattctttagt---nnnnnnnnggcatagatatgattctctaatagccatgaccattgttgtc |
207 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183563 |
tacaatgagaaaatttgattatctatatcatacatatgattctttagtaaaaaaaaaaaggcatagatatgattctctaatagccatgaccattgttgt- |
40183465 |
T |
 |
| Q |
208 |
gacggtggcttatggcgacgggtcaaaaatccaccataaacatatggtggatgaagtagtggcaaatggcaaaagcacgtggcaaatttaggnnnnnnnt |
307 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
40183464 |
---------------cgacgggtcagaaatccaccataaacatacggtggatgaagtagtggcaaatggcagaagcacgtggcaaatttaggaaaaaaat |
40183380 |
T |
 |
| Q |
308 |
tattataaatatatacctgcaaaa |
331 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
40183379 |
tattataaatatatacgtgcaaaa |
40183356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University