View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4603-Insertion-13 (Length: 298)
Name: NF4603-Insertion-13
Description: NF4603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4603-Insertion-13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 8 - 179
Target Start/End: Complemental strand, 60392 - 60224
Alignment:
| Q |
8 |
agttagagtcgtatatgagtcacttatcaacagctcgactcaactgtttaattaacttattttaaaaacgatatgagtttcaatcttagctggacaatct |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
60392 |
agttagagtcgtatatgattcacttatcaacagctcgactcaactggttaattaacttatt--aaaaacgat-tgagtttcaatcttagctggacaatct |
60296 |
T |
|
| Q |
108 |
tttgaccatatttaacttattatttgaccgaatttcatattatcagaaccattttatggaagagttaaaact |
179 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
60295 |
tttgaccatatttaatttattatttggccaaatttcatattatcagaaccattttatcgaagagttaaaact |
60224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 246 - 298
Target Start/End: Complemental strand, 60157 - 60105
Alignment:
| Q |
246 |
cacatgtcaattcactcatgtccaattgtgagtactgatttaacttagcctta |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
60157 |
cacatgtcaattcactcatgtccaattgtgagtactgatttaacttaccctta |
60105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University