View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4603_high_15 (Length: 244)
Name: NF4603_high_15
Description: NF4603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4603_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 38293695 - 38293907
Alignment:
| Q |
1 |
taagccttcttttggttagtataagcttttgttggtatttctaaatttagtggtgtgtatttagtagtgtgtatttctaaattttagatctttattttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38293695 |
taagccttcttttggttagtataagcttttgttggtatttctaaatttagtggtgtgtattt--------------ctaaattttagatctttattttta |
38293780 |
T |
 |
| Q |
101 |
tagaaggggtgnnnnnnnataaagaaaattttggtggagaaatggtatccgagtctaagacatagaatctatggaaagaagnnnnnnnnctaatgaagct |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||| ||| |
|
|
| T |
38293781 |
tagaaggggtgtttctttataaagaaaattttggtggagaaatggtatctaagtctaagacatagaatctatagaaagaa-aaaaaaaactaatgatgct |
38293879 |
T |
 |
| Q |
201 |
cagactaatcaaatatatatgtattttt |
228 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
38293880 |
caaactaatcaaatatatatgtattttt |
38293907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University