View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4603_high_8 (Length: 385)

Name: NF4603_high_8
Description: NF4603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4603_high_8
NF4603_high_8
[»] chr2 (2 HSPs)
chr2 (24-76)||(3228271-3228323)
chr2 (25-76)||(3338651-3338702)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 3228271 - 3228323
Alignment:
24 gattactttcttaaatgcatgcatttggctaatttttgtcgttgattcatgat 76  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
3228271 gattactttcttaaatgcatgcatttggctaatttttgtcgttgattcatgat 3228323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 25 - 76
Target Start/End: Original strand, 3338651 - 3338702
Alignment:
25 attactttcttaaatgcatgcatttggctaatttttgtcgttgattcatgat 76  Q
    |||||||||||||||||||||||||||||| ||||| |||||||||||||||    
3338651 attactttcttaaatgcatgcatttggctattttttttcgttgattcatgat 3338702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University