View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4603_low_18 (Length: 240)
Name: NF4603_low_18
Description: NF4603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4603_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 9593859 - 9594063
Alignment:
| Q |
19 |
gttagtcctggaactgttccagtttatcatagtacaaacatgaaagtgttggataggagggttagaataactgagttggttttgaggtttgtgaatcttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9593859 |
gttagtcctggaactgttccagtttatcatagtacaaacatgaaagtgttggataggagggttagaataactgagttggttttgaggtttgtgaatcttg |
9593958 |
T |
 |
| Q |
119 |
gtttaggagttcttgctgttgttcttattgtcactgattcacaagttagagagtttttcaccattcagaagaaagctaaattcactgacatgaaggcttt |
218 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9593959 |
gcttaggagttcttgcagttgttcttattgtcactgattcacaagttagagagtttttcaccattcagaagaaagctaaattcactgacatgaaggcttt |
9594058 |
T |
 |
| Q |
219 |
agtgt |
223 |
Q |
| |
|
||||| |
|
|
| T |
9594059 |
agtgt |
9594063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University