View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4604-Insertion-7 (Length: 894)
Name: NF4604-Insertion-7
Description: NF4604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4604-Insertion-7 |
 |  |
|
| [»] chr4 (101 HSPs) |
 |  |
|
| [»] scaffold0049 (2 HSPs) |
 |  |  |
|
| [»] scaffold0258 (2 HSPs) |
 |  |  |
|
| [»] scaffold0187 (6 HSPs) |
 |  |  |
|
| [»] scaffold0168 (2 HSPs) |
 |  |  |
|
| [»] scaffold0057 (5 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (2 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (2 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (2 HSPs) |
 |  |  |
|
| [»] scaffold0242 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-107; HSPs: 101)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-107
Query Start/End: Original strand, 547 - 894
Target Start/End: Original strand, 9462131 - 9462477
Alignment:
| Q |
547 |
atttcggtattcgacgatttatctatttaaacgtgcatctctcttctttaacaaactgccaaaatgatatttaactattgtacaaagtaattcagtttaa |
646 |
Q |
| |
|
||||||||||| | | ||||| ||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||| ||||| || || ||||||| |
|
|
| T |
9462131 |
atttcggtatttggcaatttagctatttaaacgtgcacatctcttctttaacaaacttccaatatgatatttaactattgaacaaatta-ttaagtttaa |
9462229 |
T |
 |
| Q |
647 |
at-tcctattttcgtctaattatatgttggaaaaatatagatgtcacataagtttacaacaattagtggaaaactacac--tgaattagacatttcttct |
743 |
Q |
| |
|
| |||| || | |||||||||||||| ||||||||| ||||| |||| || ||| || ||||| | ||||||||| |||| | ||||||||||| |
|
|
| T |
9462230 |
aagtcctgttgttgtctaattatatgtcggaaaaatagagatgatacatgagcttaaaa---ttagtagcaaactacacactgaagttcacatttcttct |
9462326 |
T |
 |
| Q |
744 |
gaaatacaagaatcaccaactatcaaatacctgttttttatttcttctgtaactacaaagaaaatcaatacattgatcatatcaaaccaaatatgatgta |
843 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462327 |
gaaatacaagaatcaccaactatcaaatacctgttttttatttcttctgtaattacaaagaaaatcaatacattgatcatatcaaaccaaatatgatgta |
9462426 |
T |
 |
| Q |
844 |
attaccaaaataattaatgactaaatatttaacctagaaaaggcttttgtt |
894 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462427 |
attaccaaaataattaatgactaaatatttaacctagaaaaggcttttgtt |
9462477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 9462050 - 9462129
Alignment:
| Q |
8 |
gttatacaccacttcttccatgaaggcatgacactattaaacaagcgttcatttctagtccgccaaatagaccaaacaag |
87 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
9462050 |
gttatacaccacttcttccacgaaggcacgacactattaaacaagtgttcatttctaatccgccaaatagaccaaacaag |
9462129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 20224944 - 20225019
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
20224944 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctctt |
20225019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 48598998 - 48598923
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
48598998 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
48598923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 5648219 - 5648324
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
5648219 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
5648317 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
5648318 |
gtacaat |
5648324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 6430800 - 6430695
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| || |||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
6430800 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
6430702 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
6430701 |
gtacaat |
6430695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 156 - 260
Target Start/End: Complemental strand, 16408777 - 16408672
Alignment:
| Q |
156 |
aaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacg |
254 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | ||||||| || || |
|
|
| T |
16408777 |
aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcg |
16408678 |
T |
 |
| Q |
255 |
tacaat |
260 |
Q |
| |
|
|||||| |
|
|
| T |
16408677 |
tacaat |
16408672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 20639738 - 20639655
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
20639738 |
ctgcgtacaatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
20639655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 153 - 260
Target Start/End: Original strand, 21646922 - 21647030
Alignment:
| Q |
153 |
gataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||| |||||||| |||||| ||||||||||| |||||| | |||||| |||||||||| |
|
|
| T |
21646922 |
gataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaaggct |
21647021 |
T |
 |
| Q |
252 |
acgtacaat |
260 |
Q |
| |
|
|||||||| |
|
|
| T |
21647022 |
gcgtacaat |
21647030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 30352661 - 30352577
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||| | ||||||||||||||| | |||||| ||||||| ||||||||||||| |
|
|
| T |
30352661 |
ctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctttttt |
30352577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 347 - 427
Target Start/End: Complemental strand, 33836564 - 33836484
Alignment:
| Q |
347 |
atacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||| |||||||||||||||| |
|
|
| T |
33836564 |
atacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttttt |
33836484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 5306838 - 5306763
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
5306838 |
taaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
5306763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 17315473 - 17315398
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
17315473 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctctt |
17315398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 23501848 - 23501927
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
23501848 |
tacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt |
23501927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 16911522 - 16911628
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||||| |||| |||||| |||||| | || ||| | |||||||||| | |
|
|
| T |
16911522 |
taaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggctgc |
16911621 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
16911622 |
gtacaat |
16911628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 355 - 424
Target Start/End: Complemental strand, 44363199 - 44363130
Alignment:
| Q |
355 |
caccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
44363199 |
caccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
44363130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 10660364 - 10660439
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
10660364 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctctt |
10660439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 10874509 - 10874584
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
10874509 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctctt |
10874584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 14590797 - 14590872
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||| |||| |||| |||||| |||||| |
|
|
| T |
14590797 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctctt |
14590872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 23501753 - 23501808
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
23501753 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttca |
23501808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 47528703 - 47528628
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
47528703 |
taaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctt |
47528628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 30639340 - 30639445
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||| |||||||||||| |||||| ||||||||||| ||||| | |||||| | |||||||||| | |
|
|
| T |
30639340 |
taaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaa-cagggtaaggctgc |
30639438 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
30639439 |
gtacaat |
30639445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 20225130 - 20225211
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||||| |
|
|
| T |
20225130 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20225211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 11054321 - 11054253
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
11054321 |
taactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaaca |
11054253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 16408682 - 16408598
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||| ||| |||| |||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
16408682 |
ctgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
16408598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 13256480 - 13256397
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |||| || | |||| | |||||| |||||||||||||||||||| |
|
|
| T |
13256480 |
ctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgcccttttt |
13256397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 37494811 - 37494886
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| | |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37494811 |
taaccttggtgcaactggtaaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctctt |
37494886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 16911618 - 16911700
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||| ||| | |||||| | |||||||||||||||| |
|
|
| T |
16911618 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctttt |
16911700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 343 - 421
Target Start/End: Original strand, 21647020 - 21647098
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccc |
421 |
Q |
| |
|
|||| ||||||| ||||| ||| ||||||||||||||||||||| || |||||| | |||||| ||||||||||||||| |
|
|
| T |
21647020 |
ctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 366 - 424
Target Start/End: Complemental strand, 38755966 - 38755908
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
38755966 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38755908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 16494273 - 16494326
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
16494273 |
ctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcg |
16494326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 366 - 427
Target Start/End: Original strand, 32484310 - 32484371
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
32484310 |
gtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt |
32484371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 487306 - 487235
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||||| ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
487306 |
ccttggcgtaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctctt |
487235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 5313169 - 5313101
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
5313169 |
taaccttggcgtaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaattcctgaaaaca |
5313101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 5648314 - 5648395
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||| | ||||| |||||||||||||| |
|
|
| T |
5648314 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttttt |
5648395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 424
Target Start/End: Original strand, 11394924 - 11394987
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
11394924 |
aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11394987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 424
Target Start/End: Original strand, 11404651 - 11404714
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
11404651 |
aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11404714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 260
Target Start/End: Original strand, 19027823 - 19027914
Alignment:
| Q |
170 |
tggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||| ||||||| ||| ||| ||||||||||||||||||| ||||||||||||| |||| | |||||| | |||||||||| |||||||| |
|
|
| T |
19027823 |
tggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaat |
19027914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 348 - 426
Target Start/End: Original strand, 25629110 - 25629186
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||| | |||||| | |||||| |||||||||||||||||||| |
|
|
| T |
25629110 |
tacaatacaccaaa--tggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgcccttttt |
25629186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 30352766 - 30352691
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| | ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
30352766 |
taaccttggcgcaactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctctt |
30352691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 20225038 - 20225117
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||| |
|
|
| T |
20225038 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 366 - 424
Target Start/End: Original strand, 25388253 - 25388311
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
25388253 |
gtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt |
25388311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 30690255 - 30690176
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |||||| || |||||||| |
|
|
| T |
30690255 |
ctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt |
30690176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 361 - 427
Target Start/End: Original strand, 38786681 - 38786747
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
38786681 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
38786747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 370 - 424
Target Start/End: Complemental strand, 40553991 - 40553937
Alignment:
| Q |
370 |
gaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
40553991 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 42164317 - 42164248
Alignment:
| Q |
160 |
ttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||| |||||| ||||| ||||||| ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
42164317 |
ttggcgcaac-ggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctctt |
42164248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 366 - 424
Target Start/End: Original strand, 44718644 - 44718702
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
44718644 |
gtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt |
44718702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 289 - 344
Target Start/End: Complemental strand, 49268805 - 49268746
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggc----ccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49268805 |
tggcccatttctatagtcgggcctctcgggctaggccgggccggcccatttgacacctct |
49268746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 423
Target Start/End: Complemental strand, 6430705 - 6430627
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| |||||||||||||| | |||||||| |||||| ||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
6430705 |
ctgcgtacaatacaccaaa--tggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 9987913 - 9987831
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
9987913 |
ctgcatacaatacaccaaa--tggtgggaccccttccttgaccttgcatatgcgggagctttaatgcaccgggctgccttttttt |
9987831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 10660460 - 10660544
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| ||| |||||||||||| | ||||||| |||| |||||||||| ||||| |
|
|
| T |
10660460 |
ctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccccttttt |
10660544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 10874605 - 10874689
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| ||| |||||||||||| | ||||||| |||| |||||||||| ||||| |
|
|
| T |
10874605 |
ctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccccttttt |
10874689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 30639435 - 30639517
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||| ||||||||||| |||||||| |||||| | |||||| ||||| ||||||||||||||| |
|
|
| T |
30639435 |
ctgcgtacaatacaccaaa--tggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctttttt |
30639517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 374 - 427
Target Start/End: Original strand, 35532077 - 35532130
Alignment:
| Q |
374 |
ccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
35532130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 20908716 - 20908633
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||| |||||||||||||| | |||||| ||||| || ||||||||||| |
|
|
| T |
20908716 |
ctgcgtacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctttttt |
20908633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 422
Target Start/End: Complemental strand, 29207977 - 29207900
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||| |
|
|
| T |
29207977 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 36816464 - 36816381
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||||| ||||||| ||||||| | |||||| || |||||||||||||||||| |
|
|
| T |
36816464 |
ctgcgtacaatacaccaaaaag-gtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctttttt |
36816381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 54175119 - 54175202
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggacccctt-cccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||| ||| |||||||| |||||| | |||||| ||||||||| |||||||||| |
|
|
| T |
54175119 |
ctgcgtacaatacaccaaaa-tggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgcccttttt |
54175202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 54640510 - 54640439
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||| ||||| ||| ||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
54640510 |
ccttggcgcaac-ggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctctt |
54640439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 20405053 - 20405104
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacggg |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
20405053 |
taaccttgacgcaactggtaaagttgttgtcatgtgactggaaggtcacggg |
20405104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 361 - 428
Target Start/End: Original strand, 35567242 - 35567309
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| |||| | |||||| ||||||||| |||||||||||| |
|
|
| T |
35567242 |
aaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctttttta |
35567309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 43035224 - 43035283
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
43035224 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtccaggaaacaacctctt |
43035283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 51865117 - 51865037
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||| ||||||||| ||||||||||||||| | |||||| |||||||| ||||||||| |
|
|
| T |
51865117 |
ctgcgtacaatacaccaaa--tggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgccctttt |
51865037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 230
Target Start/End: Original strand, 25463111 - 25463157
Alignment:
| Q |
184 |
tcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25463111 |
tcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctctt |
25463157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 32629436 - 32629368
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| ||||||||||| |||||| ||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
32629436 |
ccttggcgcaac-ggtaaagttgt---catgtgactgaaaggtcacgggttcaaatcctcgaaacagcctctt |
32629368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 230
Target Start/End: Original strand, 40915802 - 40915864
Alignment:
| Q |
168 |
actggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
40915802 |
actggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctctt |
40915864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 260
Target Start/End: Complemental strand, 41018945 - 41018863
Alignment:
| Q |
178 |
ttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctttataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||| ||| ||| ||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
41018945 |
ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggtaaggctacgtacaat |
41018863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 230
Target Start/End: Original strand, 54966983 - 54967056
Alignment:
| Q |
156 |
aaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| |||||||||||| ||||| | ||||||| |||||||| |
|
|
| T |
54966983 |
aaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctctt |
54967056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 348 - 423
Target Start/End: Complemental strand, 7909355 - 7909281
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgg-gctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||||||||| || |||||| |||| |||||||||||| |
|
|
| T |
7909355 |
tacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 11054227 - 11054145
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | | || |||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
11054227 |
ctgcgtacaatacaccaaa--tggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
11054145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 292 - 344
Target Start/End: Complemental strand, 28972588 - 28972531
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
344 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28972588 |
cccatttctatagtcgggcctctcgggcccgggctgggccggcccatttgacacctct |
28972531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 423
Target Start/End: Original strand, 40915884 - 40915962
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| |||||||||||||| | |||||| |||||||| ||||||||||||||| | |||| | |||||||| |||||||| |
|
|
| T |
40915884 |
ctgcgtacaatacaccaaa--tggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 47444013 - 47444095
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| ||||| | |||| | ||||| ||||||||||||||| |
|
|
| T |
47444013 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgccctttttt |
47444095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 425
Target Start/End: Complemental strand, 47482918 - 47482849
Alignment:
| Q |
356 |
accaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| | ||||| |||| || | ||||||||| |
|
|
| T |
47482918 |
accaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctttt |
47482849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 47528609 - 47528527
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||| |||| | | ||| || ||||||||||||||||||||| |
|
|
| T |
47528609 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctttttt |
47528527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 351 - 428
Target Start/End: Original strand, 54730314 - 54730391
Alignment:
| Q |
351 |
aatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||||||||| ||| ||| |||||||||| ||||||||||||||| | |||||| ||||||| || |||||||||| |
|
|
| T |
54730314 |
aatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccgaattaccctttttta |
54730391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 289 - 344
Target Start/End: Complemental strand, 1763429 - 1763369
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1763429 |
tggcccatttcaatagtcgggcctctcgggcccgagccgggccggcccatttgacacctct |
1763369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 423
Target Start/End: Complemental strand, 8473701 - 8473621
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccaga--ccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| | |||||| |||||| | |||||| ||||||||||||||||| |
|
|
| T |
8473701 |
ctgcatacaatacaccaaa--tggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 9832392 - 9832311
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| ||||| | || || |||||||||||||||||||| |
|
|
| T |
9832392 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcccttttt |
9832311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 219
Target Start/End: Complemental strand, 13256572 - 13256508
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctgga |
219 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||| ||||||| |||||| ||||||| |
|
|
| T |
13256572 |
taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcataggttcaagtcctgga |
13256508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 361 - 425
Target Start/End: Original strand, 14983906 - 14983970
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| || ||| ||||||||||| |
|
|
| T |
14983906 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt |
14983970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 348 - 424
Target Start/End: Original strand, 20405148 - 20405224
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||| ||||| || |||||| | |||||| |||| |||||||||||| |
|
|
| T |
20405148 |
tacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgcccttt |
20405224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 348 - 411
Target Start/End: Complemental strand, 41018868 - 41018807
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcac |
411 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
41018868 |
tacaatacaccaaa--tagtgggaccccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 228
Target Start/End: Complemental strand, 44363294 - 44363234
Alignment:
| Q |
168 |
actggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| ||||| ||||| ||||| |||| |
|
|
| T |
44363294 |
actggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctc |
44363234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 48598904 - 48598823
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| ||| ||||| | ||| || |||||||||||||||||||| |
|
|
| T |
48598904 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcccttttt |
48598823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 289 - 328
Target Start/End: Original strand, 6377622 - 6377661
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
328 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
6377622 |
tggcccatttctatagtcgggcctctcgggcccgagccgg |
6377661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 190
Target Start/End: Original strand, 18969701 - 18969736
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18969701 |
taaccttggcgcaactggtaaagttgttgtcatgtg |
18969736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 289 - 328
Target Start/End: Original strand, 28185587 - 28185626
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
328 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28185587 |
tggcccatttctatagtcgggcctctcgggcccgagccgg |
28185626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 230
Target Start/End: Complemental strand, 30496491 - 30496420
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||| ||||||||||||| ||||| || |||||||| |||||| |
|
|
| T |
30496491 |
cttggcgcaactgtaaaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctctt |
30496420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 54730209 - 54730284
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||||||| | |||||||||||||||| |||| |||||| |||||| |
|
|
| T |
54730209 |
taactttggcgcaatcggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctctt |
54730284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 55766641 - 55766590
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacggg |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| | | ||||||||||| |
|
|
| T |
55766641 |
taaccttgacgcaactggtaaagttgttgtcatgtgaccggaaggtcacggg |
55766590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 8473790 - 8473720
Alignment:
| Q |
160 |
ttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||||||| |||| || | | ||||| |||||||| ||||||||||| |||||| |
|
|
| T |
8473790 |
ttggcgcaactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctctt |
8473720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 366 - 396
Target Start/End: Original strand, 8820585 - 8820615
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcg |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8820585 |
gtgggaccccttcccagaccctgcgtatgcg |
8820615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 260
Target Start/End: Complemental strand, 17043549 - 17043463
Alignment:
| Q |
175 |
aagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
|||||||| ||| ||| |||||||||||| |||||| ||||||||||| |||||| | ||||| | |||||||||| |||||||| |
|
|
| T |
17043549 |
aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaat |
17043463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 361 - 427
Target Start/End: Original strand, 28494223 - 28494289
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||| | ||| || ||||||||| |||| |||||| |
|
|
| T |
28494223 |
aaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgccttttttt |
28494289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 230
Target Start/End: Complemental strand, 39077948 - 39077894
Alignment:
| Q |
176 |
agttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
39077948 |
agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctctt |
39077894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 12257764 - 12257700
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||| |||||| |||||||||||| ||| ||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
12257764 |
ccttgacgcaac-ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaaatcctagaaaca |
12257700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 343 - 395
Target Start/End: Complemental strand, 17043473 - 17043423
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
395 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
17043473 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgcatatgc |
17043423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 49938668 - 49938612
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggcttta |
405 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||||| |||||| | |||||| |
|
|
| T |
49938668 |
tacaatacaccaaaa-tggtgggaccccttcccataccctgcatatgcgggagcttta |
49938612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 230
Target Start/End: Complemental strand, 49938759 - 49938690
Alignment:
| Q |
161 |
tggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||| | ||||||||| ||| ||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
49938759 |
tggcgcaacggtaaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctctt |
49938690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 366 - 427
Target Start/End: Complemental strand, 50555714 - 50555653
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||| |||||||||||||| | | |||| ||||||||| ||||||||||| |
|
|
| T |
50555714 |
gtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccctttttt |
50555653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 1e-31; HSPs: 75)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 14530278 - 14530384
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |||||||| | |||||||||||| |
|
|
| T |
14530278 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctac |
14530377 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
14530378 |
gtacaat |
14530384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 12024093 - 12023988
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
12024093 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
12023995 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
12023994 |
gtacaat |
12023988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 10543754 - 10543835
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
10543754 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 8455491 - 8455385
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | ||||| | |||||||||| | |
|
|
| T |
8455491 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaaggctgc |
8455392 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
8455391 |
gtacaat |
8455385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 10543658 - 10543764
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||| |||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
10543658 |
taaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaaggctgc |
10543757 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
10543758 |
gtacaat |
10543764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 348 - 424
Target Start/End: Original strand, 14530379 - 14530455
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
14530379 |
tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
14530455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 11514396 - 11514471
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
11514396 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctctt |
11514471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 24200800 - 24200694
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| |||||| |||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
24200800 |
taaccttgatgcaactggtaaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
24200701 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
24200700 |
gtacaat |
24200694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 10546219 - 10546301
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
10546219 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
10546301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 9671235 - 9671315
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
9671235 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
9671315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 166 - 260
Target Start/End: Original strand, 17667973 - 17668068
Alignment:
| Q |
166 |
caactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||| |||||||| | |||||| | |||||||||| |||||||| |
|
|
| T |
17667973 |
caactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaat |
17668068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 21779434 - 21779359
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||| ||||||| ||| |||||| |
|
|
| T |
21779434 |
taaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctctt |
21779359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 23397726 - 23397801
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
23397726 |
taaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctctt |
23397801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 350 - 425
Target Start/End: Original strand, 23488544 - 23488619
Alignment:
| Q |
350 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||| ||||| |
|
|
| T |
23488544 |
caatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttt |
23488619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 25079893 - 25079818
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
25079893 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctctt |
25079818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 289 - 344
Target Start/End: Original strand, 42808528 - 42808583
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42808528 |
tggcccatttctatattcgggcctctcgggcccgggccggcccatttgacacctct |
42808583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 24200704 - 24200622
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||||||| |||||| |||||||| ||||||| ||||| | | |||||| ||||||||||||||||||| |
|
|
| T |
24200704 |
ctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 344 - 426
Target Start/End: Complemental strand, 31158519 - 31158437
Alignment:
| Q |
344 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||| | |||||| | |||| | ||| ||||||| |
|
|
| T |
31158519 |
tgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacctgattgtccttttt |
31158437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 9671140 - 9671216
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggct-gaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| || |||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
9671140 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctctt |
9671216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 8455395 - 8455315
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
8455395 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctttt |
8455315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 260
Target Start/End: Original strand, 17623535 - 17623630
Alignment:
| Q |
166 |
caactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||||||||||||| ||||| | ||| ||||||||||||||| |||| ||||||||||||| | |||||| | |||||||||| |||||||| |
|
|
| T |
17623535 |
caactggtaaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaat |
17623630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 17896219 - 17896294
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| | |||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
17896219 |
taaccttgacgcaactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctctt |
17896294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 361 - 427
Target Start/End: Original strand, 14444800 - 14444866
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| |||||| |||||||||||||| |
|
|
| T |
14444800 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctttttt |
14444866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 230
Target Start/End: Original strand, 5450263 - 5450320
Alignment:
| Q |
173 |
taaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5450263 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctctt |
5450320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 228
Target Start/End: Original strand, 22371017 - 22371090
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| ||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
22371017 |
taaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctc |
22371090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 25249817 - 25249735
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | |||||| |||||||| |||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
25249817 |
ctgcgtacaatacaccaaa--tggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctttttt |
25249735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 36871548 - 36871629
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| |||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
36871548 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgccctttttt |
36871629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 231
Target Start/End: Complemental strand, 19977889 - 19977813
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctcttt |
231 |
Q |
| |
|
||||||||||| ||||||| |||||||| ||||||| | ||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
19977889 |
taaccttggcggaactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttt |
19977813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 25249912 - 25249844
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| ||| ||||||||||||||| || |||||||| |
|
|
| T |
25249912 |
taaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaaca |
25249844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 361 - 425
Target Start/End: Original strand, 44643595 - 44643659
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| | || ||| ||||||||| ||||||||| |
|
|
| T |
44643595 |
aaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttt |
44643659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 11514492 - 11514571
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| ||||||||||||||||||||| | |||||| |||||||| |||||||||| |
|
|
| T |
11514492 |
ctgcgtacaatacaccaaa--tggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgccctttt |
11514571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 17705455 - 17705522
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaac |
222 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
17705455 |
taaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaac |
17705522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 202
Target Start/End: Original strand, 27573581 - 27573628
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
27573581 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtca |
27573628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 366 - 429
Target Start/End: Original strand, 34766332 - 34766395
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
429 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||| |||||| ||||||||||| |
|
|
| T |
34766332 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttttttat |
34766395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 260
Target Start/End: Complemental strand, 40417031 - 40416940
Alignment:
| Q |
170 |
tggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||||||| || ||||||||||||||| |||||||| | ||| |||||| ||||||| |
|
|
| T |
40417031 |
tggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaat |
40416940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 7214494 - 7214600
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||| ||||||||||| ||||||| || |||||||| ||||| | ||||| | |||||||||| | |
|
|
| T |
7214494 |
taactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaaggctgc |
7214593 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
7214594 |
gtacaat |
7214600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 348 - 425
Target Start/End: Complemental strand, 21779335 - 21779260
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
21779335 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21779260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 366 - 424
Target Start/End: Complemental strand, 25079775 - 25079717
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
25079775 |
gtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 348 - 425
Target Start/End: Original strand, 5841089 - 5841166
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||| ||||||||||| |
|
|
| T |
5841089 |
tacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttt |
5841166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 161 - 230
Target Start/End: Complemental strand, 39914475 - 39914406
Alignment:
| Q |
161 |
tggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||| ||||||||||| ||| | |||||||||||||||| |
|
|
| T |
39914475 |
tggcgcatctggtaaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctctt |
39914406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 40579807 - 40579750
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| | |||||| ||||||||||||||||| |
|
|
| T |
40579807 |
gtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 44521544 - 44521473
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||| |||||||||||||||| ||| ||||||||||||| ||||| ||| ||||||||| ||||| |
|
|
| T |
44521544 |
ccttggcggaac-ggtaaagttgttatcacgtgactgaaaggtcacgcgttcaaatcttggaaacaatctctt |
44521473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 14544023 - 14544098
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| ||||||||| || ||| || | ||||||||| |||||| |
|
|
| T |
14544023 |
taaccttggcgcaattggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctctt |
14544098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 366 - 425
Target Start/End: Original strand, 34080178 - 34080237
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | | |||| ||||||||||||||||||| |
|
|
| T |
34080178 |
gtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttt |
34080237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 230
Target Start/End: Original strand, 44604826 - 44604889
Alignment:
| Q |
167 |
aactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||| |||||||||| ||||||| ||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
44604826 |
aactgctaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctctt |
44604889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 229
Target Start/End: Complemental strand, 24860157 - 24860087
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctct |
229 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||| ||||| ||||||| | |||||||||||||||| |
|
|
| T |
24860157 |
cttggcgcaactggtaaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctct |
24860087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 260
Target Start/End: Original strand, 19614981 - 19615058
Alignment:
| Q |
184 |
tcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| |||||| |||||| |||||||| | ||||||| || |||||||| |
|
|
| T |
19614981 |
tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaat |
19615058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 376 - 425
Target Start/End: Original strand, 22371199 - 22371248
Alignment:
| Q |
376 |
ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
22371248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 361 - 426
Target Start/End: Complemental strand, 26684683 - 26684618
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||| |||||| |||||||||||||| | ||||||||||||||| ||| ||||||| |
|
|
| T |
26684683 |
aaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtccttttt |
26684618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 292 - 344
Target Start/End: Complemental strand, 26827039 - 26826982
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
344 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26827039 |
cccatttctatagtcgggcctctcgggcccgggctgggccggcccatttgacacctct |
26826982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 260
Target Start/End: Complemental strand, 32781461 - 32781357
Alignment:
| Q |
156 |
aaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacg |
254 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| |||||||||||||| ||||| || |||||||||||||| | |||||| | ||||||| || || |
|
|
| T |
32781461 |
aaccttggcgcaa-tggtaaagttgttgcaatgttgctgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcg |
32781363 |
T |
 |
| Q |
255 |
tacaat |
260 |
Q |
| |
|
|||||| |
|
|
| T |
32781362 |
tacaat |
32781357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 259
Target Start/End: Original strand, 33795261 - 33795350
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaa |
259 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||| ||| |||||||||||||| |||||| | |||||||||| ||||||| |
|
|
| T |
33795261 |
ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaa |
33795350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 348 - 424
Target Start/End: Complemental strand, 40762308 - 40762234
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||||||| | ||||||||| |||| ||||||||||||| | | |||||| |||||||||||||||||| |
|
|
| T |
40762308 |
tacaatacaccaaa--tggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 427
Target Start/End: Original strand, 41409939 - 41410000
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | |||| | |||||||||||||||| |||| |
|
|
| T |
41409939 |
gtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccctctttt |
41410000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 289 - 342
Target Start/End: Original strand, 44089183 - 44089236
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacct |
342 |
Q |
| |
|
|||||||||| |||||| |||||||||||| ||||||| | ||||||||||||| |
|
|
| T |
44089183 |
tggcccatttatatagtcgggcctctcggggccgggccaggccatttgacacct |
44089236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 412
Target Start/End: Complemental strand, 44449463 - 44449395
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcacc |
412 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |||||||||| || | | | ||||||||||| |
|
|
| T |
44449463 |
ctgcgtacaatacaccaaaa-tagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcacc |
44449395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 99434 - 99363
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| | |||||||||| ||| ||| ||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
99434 |
ccttggcgcaacag-taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctctt |
99363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 5840988 - 5841056
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||||| |||| || |||||||||| ||||||| ||| ||||||||||||||| |||| |||||| |
|
|
| T |
5840988 |
taaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaaca |
5841056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 260
Target Start/End: Original strand, 10546153 - 10546229
Alignment:
| Q |
186 |
atgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tat-aaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |||||| ||| ||||| | |||||||||| |||||||| |
|
|
| T |
10546153 |
atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaat |
10546229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 17380407 - 17380336
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||| | ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
17380407 |
ccttggcgcaa-tggcgaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctctt |
17380336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 39189596 - 39189556
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
39189596 |
taaccttggcgcaactggtaaagttgttgtcatgtgactga |
39189556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 44643486 - 44643537
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||||||||||||| ||||| |
|
|
| T |
44643486 |
ccttggcgcaa-tggtaaagttgtcatcatgtgactgaaaggtcacgtgttca |
44643537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 369 - 424
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
| Q |
369 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||||| ||||||||||||| | | |||||| |||||| ||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt |
8576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 198
Target Start/End: Complemental strand, 27466305 - 27466262
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaag |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
27466305 |
taacattggcgcaactggtaaagttgttgtcatgtgactgaaag |
27466262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 29420048 - 29419989
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
29420048 |
ggtaaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctctt |
29419989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 190
Target Start/End: Complemental strand, 39499385 - 39499354
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39499385 |
cttggcgcaactggtaaagttgttatcatgtg |
39499354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 366 - 425
Target Start/End: Complemental strand, 39914363 - 39914305
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||| |||| |||||||||||||| |
|
|
| T |
39914363 |
gtgggaccccttcct-gaccctgcgtatgcgggagctttagtgcatcgggttgccctttt |
39914305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 428
Target Start/End: Original strand, 17668058 - 17668141
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| |||||||||||||| | |||| |||||||| | ||||||||||| | | |||||| |||||||||||||||||||||| |
|
|
| T |
17668058 |
ctgcgtacaatacaccaaa--tggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctttttta |
17668141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 32781367 - 32781316
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
396 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
32781367 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgtgtatgcg |
32781316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 230
Target Start/End: Complemental strand, 34752820 - 34752762
Alignment:
| Q |
172 |
gtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
34752820 |
gtaaacttgttatcatgtgactgaaaggtcacgaattcaagttctggaaacaacctctt |
34752762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 424
Target Start/End: Original strand, 14544136 - 14544201
Alignment:
| Q |
359 |
aaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||||||| | |||||| |||||| |||||||||| |
|
|
| T |
14544136 |
aaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttt |
14544201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 361 - 426
Target Start/End: Original strand, 17896332 - 17896397
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||| | | |||||| |||| || |||||||||||| |
|
|
| T |
17896332 |
aaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgcccttttt |
17896397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 348 - 424
Target Start/End: Original strand, 23397825 - 23397899
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||||||| | ||||||||||||| | |||||| | |||||| | ||| || |||||||||||||||||| |
|
|
| T |
23397825 |
tacaatacaccaaa--tggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcccttt |
23397899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 24860067 - 24859985
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | || | |||||||| | ||||||||||||||| | |||||| |||||||| ||||| |||||| |
|
|
| T |
24860067 |
ctgcgtacaatacaccaaa--tggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgccttttttt |
24859985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 343 - 395
Target Start/End: Original strand, 24890467 - 24890517
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
395 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
24890467 |
ctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgc |
24890517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 3e-29; HSPs: 55)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 38879541 - 38879647
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |||||||| | |||||||||| | |
|
|
| T |
38879541 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgc |
38879640 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
38879641 |
gtacaat |
38879647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 1565391 - 1565466
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1565391 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctctt |
1565466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 4619281 - 4619175
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||| | |||||| | |||||| | |||||||||| | |
|
|
| T |
4619281 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggctgc |
4619182 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
4619181 |
gtacaat |
4619175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 38879637 - 38879719
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
38879637 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
38879719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 41014279 - 41014384
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
41014279 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
41014377 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
41014378 |
gtacaat |
41014384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 155 - 228
Target Start/End: Original strand, 43334162 - 43334235
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
43334162 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctc |
43334235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 35710273 - 35710348
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
35710273 |
taaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctctt |
35710348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 37024729 - 37024654
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
37024729 |
taaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
37024654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 43334259 - 43334341
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||| ||||| | |||||| |||||||||||||||||||| |
|
|
| T |
43334259 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgcccttttt |
43334341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 24448850 - 24448956
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| ||| || | |||||| |||||||||| | |
|
|
| T |
24448850 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaaggctgc |
24448949 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
24448950 |
gtacaat |
24448956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 8170157 - 8170053
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctttataaaaagcggggtaaggctacg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | ||||||||||||||||| ||||||||||| ||| ||| | ||| | |||||||||| || |
|
|
| T |
8170157 |
taaccttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcct-tttgtgtaaaacagggtaaggctgcg |
8170059 |
T |
 |
| Q |
255 |
tacaat |
260 |
Q |
| |
|
|||||| |
|
|
| T |
8170058 |
tacaat |
8170053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 346 - 423
Target Start/End: Complemental strand, 12006406 - 12006329
Alignment:
| Q |
346 |
catacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| |||||| | |||||| ||||||| ||||||||| |
|
|
| T |
12006406 |
catacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 23974741 - 23974815
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
23974741 |
taaccttggcgcaac-ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctctt |
23974815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 4619185 - 4619103
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||| |
|
|
| T |
4619185 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctttt |
4619103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 348 - 425
Target Start/End: Original strand, 16957375 - 16957450
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
16957375 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
16957450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 27328712 - 27328818
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||| ||||| ||||||||||||| ||||||| |||||||||||| |||||| ||||||||||| ||||| | |||||| | |||||||||| | |
|
|
| T |
27328712 |
taaccttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgc |
27328811 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
27328812 |
gtacaat |
27328818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 13801848 - 13801767
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||||| |
|
|
| T |
13801848 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcccttt |
13801767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 24448946 - 24449028
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
24448946 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctttttt |
24449028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 353 - 424
Target Start/End: Original strand, 25622524 - 25622595
Alignment:
| Q |
353 |
tacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||||||| ||||||||| |
|
|
| T |
25622524 |
tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 27328808 - 27328890
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| |||||||||||||| | ||||||||||| ||| ||||| |||| |
|
|
| T |
27328808 |
ctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgccttttt |
27328890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 224
Target Start/End: Original strand, 22600414 - 22600483
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaa |
224 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| ||| ||||| ||||||||| |||||||||||| |
|
|
| T |
22600414 |
taaccttgacgtaactggtaaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaa |
22600483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 32703478 - 32703558
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
32703478 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
32703558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 366 - 425
Target Start/End: Original strand, 39801593 - 39801652
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | |||||| |||||||||||||| |||| |
|
|
| T |
39801593 |
gtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttt |
39801652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 366 - 427
Target Start/End: Complemental strand, 16028682 - 16028621
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
16028682 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
16028621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 8170063 - 8169982
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | | || | |||||||||||||||||||| |
|
|
| T |
8170063 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttttt |
8169982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 423
Target Start/End: Original strand, 20135660 - 20135740
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || ||||| | |||| | ||||||||||||||||| |
|
|
| T |
20135660 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 39301087 - 39301158
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
39301087 |
ccttggcgcaac-ggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctctt |
39301158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 22187245 - 22187320
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||| || |||||||||||| |||| | ||||||||||| |||||| |
|
|
| T |
22187245 |
taactttggcgcaactagtaaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctctt |
22187320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 22861841 - 22861786
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||| |||||| |||||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
22861841 |
taaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattca |
22861786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 28516593 - 28516534
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
28516593 |
ggtaaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctctt |
28516534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 41014374 - 41014454
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||| |
|
|
| T |
41014374 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
41014454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 29334451 - 29334532
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||| || | ||||||||| ||||| ||||||||||||| | | ||||||||||||||| ||||||||| |
|
|
| T |
29334451 |
ctgcgtacaatacaccagaa-tggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgccctttt |
29334532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 34154893 - 34154814
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| ||| || |||||||||||||||||| |
|
|
| T |
34154893 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt |
34154814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 349 - 405
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
| Q |
349 |
acaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggcttta |
405 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
10306548 |
acaatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 348 - 424
Target Start/End: Complemental strand, 12575735 - 12575660
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||||| | |||||||||||||| |||||||||||||| | ||||| ||||||||| |||||||| |
|
|
| T |
12575735 |
tacaatacaccaaaa-tggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgcccttt |
12575660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 373 - 425
Target Start/End: Original strand, 32354211 - 32354263
Alignment:
| Q |
373 |
cccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||| ||||||| ||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
32354263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 39079937 - 39079886
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
39079937 |
ccttggcgcaac-ggtaaagttgttgtcatgtgacagaaaggtcacgggttca |
39079886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 12006500 - 12006430
Alignment:
| Q |
160 |
ttggcgcaactggtaaagttgttatcatgtggctgaaaggtcac-gggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| | |||||||| ||||||| |||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
12006500 |
ttggcgcaactgctcaagttgttgtcatgtgactgaaaggtcacggggttca-agtctggaaacaacctctt |
12006430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 31299592 - 31299667
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| || | ||||||| ||||| |||| |||||| |||||| |
|
|
| T |
31299592 |
taaccttggtgcaactggtaaagttgttgtcatgtgacttacaggtcactagttcaagtcctagaaacagcctctt |
31299667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 2838738 - 2838788
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctg-aaaggtcacg |
204 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
2838738 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaaggtcacg |
2838788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 228
Target Start/End: Complemental strand, 10634317 - 10634248
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||| ||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
10634317 |
ccttggcgcaac-ggtgaagttgttgtcaagtgactgaaaggtcatgggttcaagtcctagaaacaacctc |
10634248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 429
Target Start/End: Complemental strand, 11657779 - 11657694
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
429 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| ||||||| | ||| | ||||| | ||||||| ||||||||||||| |
|
|
| T |
11657779 |
ctgcatacaatacacc-aaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttttttat |
11657694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 16880726 - 16880647
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||| |||| |||||| |||| |||||||||| | |||||| ||||||||||| |||||| |
|
|
| T |
16880726 |
ctgcgtacaatacaccaaa--tggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtttcccttt |
16880647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 19438709 - 19438759
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || || |||| |||||| |
|
|
| T |
19438709 |
taaccttggcgcaactggtaaagttgttgtcatatgactaaaagatcacgg |
19438759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 28516513 - 28516432
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||| ||||| | ||||||||| ||||||||||||||| |||| | |||||| || ||| |||||||||||| |
|
|
| T |
28516513 |
ctgcgtacaatacatcaaaa-tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctttt |
28516432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 366 - 424
Target Start/End: Complemental strand, 30877622 - 30877564
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||||| |||||||| |||| | | ||| || |||||||||||||||||| |
|
|
| T |
30877622 |
gtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt |
30877564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 230
Target Start/End: Original strand, 32703413 - 32703459
Alignment:
| Q |
184 |
tcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
32703413 |
tcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
32703459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 361 - 427
Target Start/End: Original strand, 35710383 - 35710449
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| || | ||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
35710383 |
aaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctttttt |
35710449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 361 - 415
Target Start/End: Original strand, 43574678 - 43574732
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccggg |
415 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| |||||||| |
|
|
| T |
43574678 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 1405170 - 1405231
Alignment:
| Q |
178 |
ttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaa |
238 |
Q |
| |
|
||||| ||||||| || ||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
1405170 |
ttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaacaacctcttatataaaaa |
1405231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 421
Target Start/End: Complemental strand, 21784396 - 21784335
Alignment:
| Q |
360 |
aaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccc |
421 |
Q |
| |
|
||||| |||||||||||| || ||||||||||||||| | | |||| ||||||| ||||||| |
|
|
| T |
21784396 |
aaaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 22187341 - 22187422
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||||| | || |||||||||||| ||||| | ||||| | |||||| |||| | ||||||||||| |
|
|
| T |
22187341 |
ctgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgcccttt |
22187422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 251
Target Start/End: Original strand, 30006285 - 30006382
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggct |
251 |
Q |
| |
|
|||| |||||||||||| |||| ||||| ||||||| ||||||||||| | |||| ||| | |||||||||||| |||||| | | |||||||||| |
|
|
| T |
30006285 |
taacattggcgcaactgataaatttgttgtcatgtgactgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggct |
30006382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 292 - 325
Target Start/End: Original strand, 34375172 - 34375205
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggcccgggc |
325 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
34375172 |
cccatttctatagtcgggcctctcgggcccgggc |
34375205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 292 - 325
Target Start/End: Original strand, 35540634 - 35540667
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggcccgggc |
325 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35540634 |
cccatttctatagtcgggcctctcgggcccgggc |
35540667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 6e-27; HSPs: 92)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 35005202 - 35005284
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
35005202 |
ctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgccctttt |
35005284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 18742038 - 18741955
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||| ||||||||||| |||||||| |
|
|
| T |
18742038 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttttt |
18741955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 34725271 - 34725196
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
34725271 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
34725196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 18944626 - 18944732
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||| |||||| |||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
18944626 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
18944725 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
18944726 |
gtacaat |
18944732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 30395903 - 30395797
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
30395903 |
taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
30395804 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
30395803 |
gtacaat |
30395797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 32632731 - 32632626
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || ||||||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
32632731 |
taaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
32632633 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
32632632 |
gtacaat |
32632626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 46991787 - 46991893
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||| ||||||||||||||| |||||||||||||||||| | |||||| | |||||||||| |
|
|
| T |
46991787 |
taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgt |
46991886 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
46991887 |
gtacaat |
46991893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 350 - 427
Target Start/End: Original strand, 50606487 - 50606564
Alignment:
| Q |
350 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
50606487 |
caatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt |
50606564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 20004171 - 20004089
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||||||| || |||||| | |||||| ||||||||||||||||||| |
|
|
| T |
20004171 |
ctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
20004089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 342 - 427
Target Start/End: Original strand, 45402174 - 45402257
Alignment:
| Q |
342 |
tctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||||||||||||||||| | |||||| ||||||||||||||| ||||| |
|
|
| T |
45402174 |
tctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccgttttt |
45402257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 348 - 425
Target Start/End: Original strand, 10668309 - 10668386
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| | ||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
10668309 |
tacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10668386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 18944722 - 18944807
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggc-tttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | || |||| ||||||||||||||||||||| |
|
|
| T |
18944722 |
ctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttttt |
18944807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 343 - 428
Target Start/End: Original strand, 27201726 - 27201811
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||| |||||||||| | |||||| |||| |||||||||||||||| |
|
|
| T |
27201726 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgccctttttta |
27201811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 22930242 - 22930174
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
22930242 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaaca |
22930174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 47214494 - 47214562
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
47214494 |
taactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaaca |
47214562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 14617021 - 14617096
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
14617021 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctctt |
14617096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 4349717 - 4349796
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
4349717 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4349796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 159 - 260
Target Start/End: Complemental strand, 18724715 - 18724614
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtac |
257 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| |||| |
|
|
| T |
18724715 |
cttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtac |
18724617 |
T |
 |
| Q |
258 |
aat |
260 |
Q |
| |
|
||| |
|
|
| T |
18724616 |
aat |
18724614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 229
Target Start/End: Complemental strand, 20004267 - 20004193
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctct |
229 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
20004267 |
taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctct |
20004193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 348 - 426
Target Start/End: Complemental strand, 42304283 - 42304205
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| ||||||||||||| | | |||||| |||||||| ||||||||||| |
|
|
| T |
42304283 |
tacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttttt |
42304205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 343 - 428
Target Start/End: Complemental strand, 46248032 - 46247949
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| || ||||||||||||||||||| |
|
|
| T |
46248032 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctttttta |
46247949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 46248128 - 46248022
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| |||||| |||||||||||| || |||||||| |||||| | |||||| | ||||||| || | |
|
|
| T |
46248128 |
taaccttggctcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaagactgc |
46248029 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
46248028 |
gtacaat |
46248022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 366 - 427
Target Start/End: Original strand, 43768239 - 43768300
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||||||||||||||||| || | |||||||||||||||| ||||||||||| |
|
|
| T |
43768239 |
gtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctttttt |
43768300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 9939443 - 9939519
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaa-gttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
9939443 |
taaccttggcgcaaccggtaaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctctt |
9939519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 157 - 260
Target Start/End: Complemental strand, 19932925 - 19932824
Alignment:
| Q |
157 |
accttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctttataaaaagcggggtaaggctacgta |
256 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| | |||| ||||||| | | |||||| | |||||||||| |||| |
|
|
| T |
19932925 |
accttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagt--tggatacaacctttgtgtaaaaaacagggtaaggctgcgta |
19932828 |
T |
 |
| Q |
257 |
caat |
260 |
Q |
| |
|
|||| |
|
|
| T |
19932827 |
caat |
19932824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 34714606 - 34714674
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||| || |||||||| |
|
|
| T |
34714606 |
taaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaaca |
34714674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 18742136 - 18742081
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
18742136 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttca |
18742081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 230
Target Start/End: Original strand, 20036208 - 20036278
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
20036208 |
cttggcgcaa-tggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactctt |
20036278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 38478455 - 38478380
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||| ||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
38478455 |
taaccttggcgcaactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctctt |
38478380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 40424725 - 40424780
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
40424725 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggccacgggttca |
40424780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 158 - 251
Target Start/End: Original strand, 22327086 - 22327179
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggct |
251 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||| |||||||||| |||||||| |||||||||||||||||| | |||||| | |||||||||| |
|
|
| T |
22327086 |
ccttggcgcaac-ggcaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggct |
22327179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 23768495 - 23768389
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||||||| ||| |||||||| |||||| || |||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
23768495 |
taacctcgacgcaactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
23768396 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
23768395 |
gtacaat |
23768389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 30395807 - 30395725
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||| ||||||||||| |
|
|
| T |
30395807 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttt |
30395725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 41319981 - 41319875
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||| | ||||||||||||||||| ||||||| |||||||||||| |||| | ||||||||||| ||||| | |||||| | |||||||||| | |
|
|
| T |
41319981 |
taaccttgacacaactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgc |
41319882 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
41319881 |
gtacaat |
41319875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 366 - 427
Target Start/End: Complemental strand, 1517369 - 1517308
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||| |||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
1517369 |
gtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttttt |
1517308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 45812616 - 45812534
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| ||||||| |||||| | ||| || |||||||||||||| |||||| |
|
|
| T |
45812616 |
ctgcatacaatacaccaaa--tggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgccttttttt |
45812534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 258
Target Start/End: Original strand, 8197026 - 8197130
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||| ||||||||| |||||||| ||||||| ||||||||||||||||||| |||||| || |||||| | |||||| | ||||||||||| |
|
|
| T |
8197026 |
taaccttggtgcaactggtcaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggtaaggctac |
8197125 |
T |
 |
| Q |
254 |
gtaca |
258 |
Q |
| |
|
||||| |
|
|
| T |
8197126 |
gtaca |
8197130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 350 - 425
Target Start/End: Original strand, 9939547 - 9939623
Alignment:
| Q |
350 |
caatacaccaaaaatagtgggacccc-ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||||| |||||||||| ||| | ||||||||||||||| | |||||| ||||||||||| ||||||| |
|
|
| T |
9939547 |
caatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccctttt |
9939623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 10668203 - 10668283
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatc-----atgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
10668203 |
taaccttggcgcaactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
10668283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 343 - 395
Target Start/End: Complemental strand, 19932834 - 19932782
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
395 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19932834 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgc |
19932782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 25290146 - 25290214
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||||||||||||| ||||| || |||||||| |
|
|
| T |
25290146 |
taaccttggcgcaacaggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaaca |
25290214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 45812710 - 45812642
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| |||||||||||| |||||| ||||| ||||| |
|
|
| T |
45812710 |
taaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaaca |
45812642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 289 - 344
Target Start/End: Original strand, 4447794 - 4447849
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||||||||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
4447794 |
tggcccatttctatagtcgggcctcttaggcccgagccggcccatttgacacctct |
4447849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 27201630 - 27201705
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||| ||| || ||||||||||||| ||||||| ||||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
27201630 |
taaccttagcgtaaatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctctt |
27201705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 366 - 425
Target Start/End: Original strand, 27474380 - 27474439
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||||||| |||||||||| |
|
|
| T |
27474380 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttt |
27474439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 45402078 - 45402152
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| | || ||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
45402078 |
taaccttggcgcaactggtaaagttgttgtcatgt-gatggaaggtaacgggttcaagtcctggaaacagcctctt |
45402152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 228
Target Start/End: Complemental strand, 2435958 - 2435889
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
2435958 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctc |
2435889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 228
Target Start/End: Complemental strand, 2436064 - 2435995
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
|||||| ||||| |||||||||||| ||| ||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2436064 |
ccttggtgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctc |
2435995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 366 - 428
Target Start/End: Original strand, 46991904 - 46991966
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
||||||||||||||| ||||||||||||| | | |||||| ||||||||||||||| |||||| |
|
|
| T |
46991904 |
gtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgcccattttta |
46991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 260
Target Start/End: Complemental strand, 25468421 - 25468332
Alignment:
| Q |
172 |
gtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||||||| ||||||| |||||||||| ||||||| |||||||||||||||||| | |||||| | |||||||| | |||||||| |
|
|
| T |
25468421 |
gtaaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaat |
25468332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 31382293 - 31382211
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| |||||||| |||||| | |||||| || |||||||||||||||||| |
|
|
| T |
31382293 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcatatgcgggagctttactgtaccgggttgccctttttt |
31382211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 35019309 - 35019390
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||||||||||||||| | |||||| ||||||||| |||| |||||| |
|
|
| T |
35019309 |
ctgcatacaatacaccaat--tggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcaccgggctgccatttttt |
35019390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 23796549 - 23796626
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||||| ||||| | |||||| ||||||||| ||||||||||| |
|
|
| T |
23796549 |
tacaatacaccaaa--tggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgggctgccctttttt |
23796626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 27474264 - 27474332
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||| || ||||||||||||||||| ||||||| |||||||||||| |||||| || |||||||| |
|
|
| T |
27474264 |
taaccttagctcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaaca |
27474332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 361 - 425
Target Start/End: Complemental strand, 34725161 - 34725097
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
34725161 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
34725097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 35253266 - 35253185
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||| ||||||||||| |
|
|
| T |
35253266 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttttt |
35253185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 19414422 - 19414477
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
||||||||||| || ||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
19414422 |
taaccttggcgtaattggtaaagttgttgtcatatgactgaaaggtcacgggttca |
19414477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 19414516 - 19414596
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
19414516 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
19414596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 19701654 - 19701732
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| ||||||||||||||| | |||||| |||||| || | ||||||||| |
|
|
| T |
19701654 |
tacaatacaccaaaa-tggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctaccctttttt |
19701732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 343 - 422
Target Start/End: Original strand, 22324971 - 22325049
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |||| ||||||||||||||| | |||||| |||||| || |||||| |
|
|
| T |
22324971 |
ctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgcgggagctttagtgcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 230
Target Start/End: Original strand, 33222971 - 33223042
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||||| || | || |||||||| |||||| |
|
|
| T |
33222971 |
cttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctctt |
33223042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 366 - 425
Target Start/End: Complemental strand, 33594189 - 33594130
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| ||||| ||| | ||||||| |
|
|
| T |
33594189 |
gtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccctttt |
33594130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 230
Target Start/End: Original strand, 6925096 - 6925158
Alignment:
| Q |
168 |
actggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||| | |||||| |
|
|
| T |
6925096 |
actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctctt |
6925158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 228
Target Start/End: Complemental strand, 6983980 - 6983911
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||| |||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
6983980 |
ccttggcgcaa-tggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctc |
6983911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 12127015 - 12126957
Alignment:
| Q |
150 |
agagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggtt |
208 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
12127015 |
agagttaaccttggcgcaactcgtaaagttgttgtcatgtaattgaaaggtcacgggtt |
12126957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 348 - 425
Target Start/End: Original strand, 14617122 - 14617197
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||| | |||||| |||||||| |||||||| |||||| | |||||| ||||||||||| ||||||| |
|
|
| T |
14617122 |
tacaatacaccaaa--tggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctttt |
14617197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 361 - 427
Target Start/End: Original strand, 30555210 - 30555276
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||| | |||||| ||||||||| || |||||||| |
|
|
| T |
30555210 |
aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgacctttttt |
30555276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 428
Target Start/End: Complemental strand, 38478361 - 38478278
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| |||||||||||||| | |||| |||||||| | |||||||| |||||| | ||| || |||||||||||||||||||||| |
|
|
| T |
38478361 |
ctgcgtacaatacaccaaa--tggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctttttta |
38478278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 4430197 - 4430148
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggtt |
208 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
4430197 |
cttggcgcagctggtaaagttgttgtcatgtgactggaaggtcacgggtt |
4430148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 427
Target Start/End: Original strand, 6925200 - 6925261
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| | ||||||||||||| | |||||| ||||||| |||||| |||||| |
|
|
| T |
6925200 |
gtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgccttttttt |
6925261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 419
Target Start/End: Complemental strand, 23768399 - 23768325
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgc |
419 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||||||||||||||||||| | |||||| |||| ||| |||| |
|
|
| T |
23768399 |
ctgcgtacaatacaccaaa--tggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 348 - 424
Target Start/End: Complemental strand, 35117842 - 35117765
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgt-atgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||| |||| | |||||| ||||||||| | |||||| |
|
|
| T |
35117842 |
tacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgggcttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 307 - 344
Target Start/End: Complemental strand, 48814166 - 48814129
Alignment:
| Q |
307 |
gggcctctcgggcccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48814166 |
gggcctcgcgggcccgggccggcccatttgacacctct |
48814129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 223
Target Start/End: Original strand, 50811926 - 50811990
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
50811926 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaaca |
50811990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 395
Target Start/End: Original strand, 6358200 - 6358251
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
395 |
Q |
| |
|
|||| ||||| ||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
6358200 |
ctgcgtacaaaacaccaaaa-tggtgggaccccttcccagaccctgcgtatgc |
6358251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 47214593 - 47214670
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||| |||||| | ||| || |||||| | || ||||||||| |
|
|
| T |
47214593 |
tacaatacaccaaa--tggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagattaccctttttt |
47214670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 52910204 - 52910275
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||||| |||||||||||| |||||| || |||||||| |||||| |
|
|
| T |
52910204 |
ccttggtgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaactcttggaaacagcctctt |
52910275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 230
Target Start/End: Original strand, 11596501 - 11596571
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||| |||||||| | | ||||||| |||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
11596501 |
cttggcgcaac-ggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctctt |
11596571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 12126916 - 12126836
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||| | ||||||||||| |
|
|
| T |
12126916 |
ctgcgtacaatacaccaaa--ttgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccctttt |
12126836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 347 - 422
Target Start/End: Complemental strand, 15511224 - 15511150
Alignment:
| Q |
347 |
atacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||| ||||||||||||| | | |||||| ||||||||| |||||| |
|
|
| T |
15511224 |
atacaatacaccaaaa-tggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 260
Target Start/End: Complemental strand, 17470517 - 17470415
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgta |
256 |
Q |
| |
|
|||||| ||||| |||||||||||| ||| ||| ||||| ||||| ||||||| |||| |||||| |||||| | |||||| | |||||||||| |||| |
|
|
| T |
17470517 |
ccttggtgcaac-ggtaaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgta |
17470419 |
T |
 |
| Q |
257 |
caat |
260 |
Q |
| |
|
|||| |
|
|
| T |
17470418 |
caat |
17470415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 32632636 - 32632556
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||| ||||||| |||||| | |||| | |||||| |||| ||||||| |
|
|
| T |
32632636 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttccctttt |
32632556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 35117927 - 35117868
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
35117927 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctctt |
35117868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 383 - 426
Target Start/End: Complemental strand, 50760281 - 50760238
Alignment:
| Q |
383 |
accctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
50760281 |
accctgcgtatgcgggagctttaatgcaccgggctgcccttttt |
50760238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 361 - 419
Target Start/End: Complemental strand, 4587626 - 4587568
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgc |
419 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | |||| | ||||||||||||| |
|
|
| T |
4587626 |
aaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 350 - 412
Target Start/End: Complemental strand, 45264472 - 45264411
Alignment:
| Q |
350 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcacc |
412 |
Q |
| |
|
||||||||||||| | ||||||||||||| |||||||||| |||||| | |||||| |||||| |
|
|
| T |
45264472 |
caatacaccaaaa-tggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 348 - 426
Target Start/End: Original strand, 50812024 - 50812100
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||||||||||||| | |||| |||||||||| ||||||||||||| | |||||||||||| ||| |||||||||| |
|
|
| T |
50812024 |
tacaatacaccaaaa-tggtgg-accccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgcccttttt |
50812100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 15511322 - 15511278
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcac |
203 |
Q |
| |
|
||||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
15511322 |
ccttggcgcaa-tggtaaagttgttgtaatgtggctgaaaggtcac |
15511278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 369 - 426
Target Start/End: Original strand, 16120819 - 16120876
Alignment:
| Q |
369 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||||||| | |||||| |||||| | ||||||||||||| || |||||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttttt |
16120876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 307 - 344
Target Start/End: Complemental strand, 20270630 - 20270593
Alignment:
| Q |
307 |
gggcctctcgggcccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20270630 |
gggcctctcgggctcgggccagcccatttgacacctct |
20270593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 35019217 - 35019297
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaa |
238 |
Q |
| |
|
|||||||||||| |||||||||||| ||| || |||||||||||| | |||| ||||| |||||||||||| |||||||| |
|
|
| T |
35019217 |
ccttggcgcaac-ggtaaagttgttgtcacatgactgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaa |
35019297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 226
Target Start/End: Complemental strand, 44485280 - 44485213
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcata-tcctggaaacaacc |
226 |
Q |
| |
|
|||||||||||| | |||||||||| ||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44485280 |
ccttggcgcaacag-taaagttgttgtcatgtgattgaaaggtcacgggtt-atagtcctggaaacaacc |
44485213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 2e-24; HSPs: 71)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 7136704 - 7136598
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||| ||||||| |||||||||||||||||| | |||||| | |||||||||| | |
|
|
| T |
7136704 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaaggctgc |
7136605 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
7136604 |
gtacaat |
7136598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 153 - 230
Target Start/End: Complemental strand, 20869673 - 20869596
Alignment:
| Q |
153 |
gataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
20869673 |
gataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
20869596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 12670423 - 12670348
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
12670423 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
12670348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 30454270 - 30454195
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
30454270 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
30454195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 28817801 - 28817695
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
28817801 |
taaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
28817702 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
28817701 |
gtacaat |
28817695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 36720756 - 36720862
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
36720756 |
taaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
36720855 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
36720856 |
gtacaat |
36720862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 39461171 - 39461065
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| | ||||||||||||||||||| ||||||||||| |||||| | |||||| | | |||||||| | |
|
|
| T |
39461171 |
taaccttggcgcaactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgc |
39461072 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
39461071 |
gtacaat |
39461065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 29521860 - 29521754
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||||||||||| |||||||||| || |||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
29521860 |
taaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaaggctgc |
29521761 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
29521760 |
gtacaat |
29521754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 39461075 - 39460993
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||| ||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
39461075 |
ctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
39460993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 44530109 - 44530215
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| || ||||||||||||||| || ||||||||||||||| | |||||| | |||||||||| | |
|
|
| T |
44530109 |
taaccttggcgcaactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
44530208 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
44530209 |
gtacaat |
44530215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 20284248 - 20284164
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaa |
238 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |||||||| |
|
|
| T |
20284248 |
taaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaa |
20284164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 21070877 - 21070793
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaa |
238 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |||||||| |
|
|
| T |
21070877 |
taaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaa |
21070793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 28407379 - 28407451
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
28407379 |
ccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctt |
28407451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 2626479 - 2626554
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| | ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
2626479 |
taaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctctt |
2626554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 12625946 - 12626026
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
12625946 |
ctgcatacaatacaccaaa--tggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
12626026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 159 - 230
Target Start/End: Original strand, 17823540 - 17823611
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
17823540 |
cttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctctt |
17823611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 24245411 - 24245478
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaac |
222 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
24245411 |
taaccttggggcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac |
24245478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 159 - 260
Target Start/End: Original strand, 6760786 - 6760888
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtac |
257 |
Q |
| |
|
|||||||||||||||||||||||| |||| || || ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| ||||| |
|
|
| T |
6760786 |
cttggcgcaactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtac |
6760885 |
T |
 |
| Q |
258 |
aat |
260 |
Q |
| |
|
||| |
|
|
| T |
6760886 |
aat |
6760888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 13160662 - 13160767
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||| ||| ||||||||||||||| |||| |||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
13160662 |
taacctcggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
13160760 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
13160761 |
gtacaat |
13160767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 348 - 426
Target Start/End: Original strand, 16013515 - 16013593
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||| |||||| | |||||| |||||||||||| ||||||| |
|
|
| T |
16013515 |
tacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttttt |
16013593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 171 - 260
Target Start/End: Original strand, 22598133 - 22598223
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||||||||| ||||||||||||||||||| | |||||| | ||||||||||| ||||||| |
|
|
| T |
22598133 |
ggtaaagttgttgtcacatgactgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaat |
22598223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 35261639 - 35261745
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| |||||||||| ||||| | |||||| | |||||||| | | |
|
|
| T |
35261639 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaaggttgc |
35261738 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
35261739 |
gtacaat |
35261745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 348 - 428
Target Start/End: Original strand, 35261740 - 35261818
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||||||||||||| | |||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
35261740 |
tacaatacaccaaa--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttta |
35261818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 7136608 - 7136524
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||| ||||||||| |
|
|
| T |
7136608 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttaccctttttt |
7136524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 20869979 - 20870063
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
20869979 |
ctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
20870063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 6760883 - 6760962
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| | ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
6760883 |
tacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
6760962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 230
Target Start/End: Complemental strand, 18164930 - 18164859
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
18164930 |
cttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
18164859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 343 - 418
Target Start/End: Complemental strand, 20284150 - 20284075
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttg |
418 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | | |||| |||||||||||| |
|
|
| T |
20284150 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 343 - 418
Target Start/End: Complemental strand, 21070778 - 21070703
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttg |
418 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | | |||| |||||||||||| |
|
|
| T |
21070778 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 8897939 - 8897833
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||||||| | | ||||||||||||| | |||||||||||||| ||| | |||||| |||||||||||| |
|
|
| T |
8897939 |
taaccctggcacaactggtaaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctac |
8897840 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
8897839 |
gtacaat |
8897833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 26954189 - 26954271
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||||||||| || |||||| | |||||| ||||| ||||||||||||| |
|
|
| T |
26954189 |
ctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccctttt |
26954271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 347 - 427
Target Start/End: Original strand, 26102577 - 26102655
Alignment:
| Q |
347 |
atacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
26102577 |
atacaatacaccaaa--tggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttttt |
26102655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 348 - 427
Target Start/End: Complemental strand, 8897838 - 8897761
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||| |||||| | |||||| |||||| |||||||||||||| |
|
|
| T |
8897838 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttttt |
8897761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 147 - 223
Target Start/End: Original strand, 25250474 - 25250550
Alignment:
| Q |
147 |
atgagagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||| ||| |||||||| ||||| ||||||||||| |
|
|
| T |
25250474 |
atgagaggtaaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaaca |
25250550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 366 - 426
Target Start/End: Complemental strand, 28817684 - 28817624
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||| ||||||||||||||| |
|
|
| T |
28817684 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcccttttt |
28817624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 174 - 230
Target Start/End: Original strand, 35105902 - 35105958
Alignment:
| Q |
174 |
aaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35105902 |
aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctctt |
35105958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 44781677 - 44781606
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44781677 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctctt |
44781606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 25250578 - 25250661
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| |||| || |||||| | | |||| |||||||||||||||||||| |
|
|
| T |
25250578 |
ctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcccttttt |
25250661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 424
Target Start/End: Original strand, 28407475 - 28407538
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||||| |||||| |||||||| | |||||| |||||||||||||||||| |
|
|
| T |
28407475 |
aaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 36720852 - 36720932
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
36720852 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctttt |
36720932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 44530205 - 44530285
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| ||||||||||||||| | |||||| |||||||||||| |||||| |
|
|
| T |
44530205 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgacctttt |
44530285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 348 - 411
Target Start/End: Complemental strand, 44781580 - 44781517
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcac |
411 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||| | |||||| ||||| |
|
|
| T |
44781580 |
tacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 13160757 - 13160836
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||| | ||| |||||||||||||| |
|
|
| T |
13160757 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcccttt |
13160836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 29521764 - 29521685
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | |||||| ||| |||||||||||||||||||| | |||||| ||||||||||||| |||| |
|
|
| T |
29521764 |
ctgcgtacaatacaccaaa--tggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 361 - 427
Target Start/End: Complemental strand, 30454160 - 30454094
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
30454160 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
30454094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 45071225 - 45071330
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| || ||||||||||||||| | ||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
45071225 |
taaccttggcgatactggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
45071323 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
45071324 |
gtacaat |
45071330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 12670329 - 12670247
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||| ||||||||| |
|
|
| T |
12670329 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccctttttt |
12670247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 16225075 - 16225156
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||| ||| |||||| |||||||| ||||| || |||||| | |||||| |||||||||||| ||||| |
|
|
| T |
16225075 |
ctgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttgtccttt |
16225156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 177 - 230
Target Start/End: Original strand, 31457155 - 31457208
Alignment:
| Q |
177 |
gttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
31457155 |
gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctctt |
31457208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 423
Target Start/End: Original strand, 45071320 - 45071398
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| |||||||||| | |||| | ||||||||||||||||| |
|
|
| T |
45071320 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 375 - 427
Target Start/End: Complemental strand, 27468141 - 27468089
Alignment:
| Q |
375 |
cttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
27468089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 289 - 344
Target Start/End: Original strand, 37698567 - 37698620
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
37698567 |
tggcccatttctatagtcgggcctc--ggggccgggccggcccatttgacacctct |
37698620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 248
Target Start/End: Original strand, 11748259 - 11748353
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc-tttataaaaagcggggtaag |
248 |
Q |
| |
|
|||| |||| ||||||||| || ||||| ||||||| |||||| |||||||||||| || |||||||| |||| ||| |||||||| ||||||| |
|
|
| T |
11748259 |
taactttggtgcaactggtgaaattgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaag |
11748353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 27507987 - 27508044
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||||||||||| |||| |
|
|
| T |
27507987 |
gtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 42083870 - 42083806
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||| |||||| ||||| ||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42083870 |
ccttggcgcaac-ggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaaca |
42083806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 384
Target Start/End: Original strand, 43942380 - 43942421
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagac |
384 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43942380 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccagac |
43942421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 366 - 426
Target Start/End: Original strand, 10857906 - 10857966
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||| ||||| |||| |||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
10857906 |
gtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgcccttttt |
10857966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 291 - 344
Target Start/End: Original strand, 18405319 - 18405374
Alignment:
| Q |
291 |
gcccatttctatagttgggcctctcgggcccgggccggc--ccatttgacacctct |
344 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
18405319 |
gcccatttctatagtcgggcctctcgggcctgagccggcggccatttgacacctct |
18405374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 289 - 344
Target Start/End: Original strand, 27127153 - 27127213
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
27127153 |
tggcccatttctatagtcgggcctctcgggcttgggccgggctggcccatttgacacctct |
27127213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 422
Target Start/End: Original strand, 29877150 - 29877227
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | || ||| |||||| || |||||| |
|
|
| T |
29877150 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 223
Target Start/End: Original strand, 31454152 - 31454216
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||| ||||||||||| |||||| ||||| ||||| |
|
|
| T |
31454152 |
cttggcgcaaccggtatagttgttgtcatgtggttgaaaggtcacatgttcatgtcctgaaaaca |
31454216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 369 - 425
Target Start/End: Original strand, 31457252 - 31457308
Alignment:
| Q |
369 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||| |||||||||||||| | ||| || |||||||| |||||||||| |
|
|
| T |
31457252 |
ggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctttt |
31457308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 361 - 425
Target Start/End: Complemental strand, 35107374 - 35107310
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||||| ||| ||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35107374 |
aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 348 - 426
Target Start/End: Complemental strand, 5135363 - 5135288
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||||||||| | ||||| ||||||||| |||||||||| |
|
|
| T |
5135363 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtgcaccgggctgcccttttt |
5135288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 26954092 - 26954167
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||| |||||| || ||||||||||||| ||||||| | ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
26954092 |
taactttggcgtaattggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctctt |
26954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 2626578 - 2626657
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||||| |||||| | |||| | |||||| | ||||||||| |
|
|
| T |
2626578 |
ctgcgtacaatacaccaaa--tgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcccttt |
2626657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 230
Target Start/End: Original strand, 12625858 - 12625924
Alignment:
| Q |
164 |
cgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||| || |||| || |||||||||| ||| |||||||||||||||||| |
|
|
| T |
12625858 |
cgcaactggtaaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctctt |
12625924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 376 - 426
Target Start/End: Complemental strand, 18164808 - 18164758
Alignment:
| Q |
376 |
ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||| ||||||||||||||| | |||||| |||||||||||||| ||||| |
|
|
| T |
18164808 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccattttt |
18164758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 366 - 415
Target Start/End: Complemental strand, 8483996 - 8483947
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccggg |
415 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
8483996 |
gtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 292 - 349
Target Start/End: Original strand, 30232764 - 30232820
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggcccgggccggcccatttgacacctctgcata |
349 |
Q |
| |
|
||||||| | ||||||||||||||| ||| ||||| ||||||||||||||||| |||| |
|
|
| T |
30232764 |
cccatttatgtagttgggcctctcgagcc-gggccagcccatttgacacctctacata |
30232820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 292 - 344
Target Start/End: Complemental strand, 44598998 - 44598941
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
344 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
44598998 |
cccatttctatagtcgggcctctcgggtccgggctgggccggcccatttgacacctct |
44598941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 2e-24; HSPs: 73)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 46354154 - 46354260
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || ||||||||||||||| |||||||||||||||||| | |||||| | |||||||||| | |
|
|
| T |
46354154 |
taaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
46354253 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
46354254 |
gtacaat |
46354260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 156 - 260
Target Start/End: Complemental strand, 11617762 - 11617657
Alignment:
| Q |
156 |
aaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacg |
254 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||| |||||||||||| |||||| |||||||||||||||||| | |||||| | ||||||| || || |
|
|
| T |
11617762 |
aacctcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcg |
11617663 |
T |
 |
| Q |
255 |
tacaat |
260 |
Q |
| |
|
|||||| |
|
|
| T |
11617662 |
tacaat |
11617657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 146 - 238
Target Start/End: Complemental strand, 42496019 - 42495926
Alignment:
| Q |
146 |
catgagagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaa |
238 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |||| || ||||||||||||||||||| ||||||||||| |||||| |||||||| |
|
|
| T |
42496019 |
catgaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaa |
42495926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 155 - 257
Target Start/End: Complemental strand, 2541195 - 2541091
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggct-gaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggcta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || ||||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| |
|
|
| T |
2541195 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg |
2541096 |
T |
 |
| Q |
253 |
cgtac |
257 |
Q |
| |
|
||||| |
|
|
| T |
2541095 |
cgtac |
2541091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 47078028 - 47077960
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
47078028 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaaca |
47077960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 48735296 - 48735220
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcc-tggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
48735296 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctctt |
48735220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 21172182 - 21172107
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
21172182 |
taaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctctt |
21172107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 32758221 - 32758296
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
32758221 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctt |
32758296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 156 - 230
Target Start/End: Complemental strand, 10693245 - 10693171
Alignment:
| Q |
156 |
aaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
10693245 |
aaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
10693171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 145 - 223
Target Start/End: Complemental strand, 35334999 - 35334921
Alignment:
| Q |
145 |
tcatgagagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| ||| ||||||||| ||||| ||||||||||| |
|
|
| T |
35334999 |
tcatgagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaaca |
35334921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 42805484 - 42805590
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| |
|
|
| T |
42805484 |
taaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgt |
42805583 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
42805584 |
gtacaat |
42805590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 43557432 - 43557538
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||||||||||| ||||||| ||||||||||| |||||| | |||||| | | |||||||| | |
|
|
| T |
43557432 |
taaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgc |
43557531 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
43557532 |
gtacaat |
43557538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 7193045 - 7193120
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||| |||| ||||||||||| ||||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
7193045 |
taaccttggcgtaacttgtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctctt |
7193120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 19427059 - 19426989
Alignment:
| Q |
160 |
ttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
19427059 |
ttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctctt |
19426989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 42798629 - 42798735
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| || |||||||| ||||| | |||||| | ||||||||| | |
|
|
| T |
42798629 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaaggctgc |
42798728 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
42798729 |
gtacaat |
42798735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 348 - 426
Target Start/End: Original strand, 42805585 - 42805663
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||||||| |
|
|
| T |
42805585 |
tacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
42805663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 47716419 - 47716525
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||| ||||||| ||||||||| |||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
47716419 |
taaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
47716518 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
47716519 |
gtacaat |
47716525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 7879694 - 7879776
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||| | ||||||||||||||||||||| |
|
|
| T |
7879694 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttttt |
7879776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 155 - 228
Target Start/End: Complemental strand, 14732997 - 14732924
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||| |||| ||||||| ||||||||||| |||| |
|
|
| T |
14732997 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctc |
14732924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 157 - 230
Target Start/End: Original strand, 27629596 - 27629669
Alignment:
| Q |
157 |
accttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || | ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27629596 |
accttggcgcaactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctctt |
27629669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 48123655 - 48123584
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
48123655 |
ccttggcgcaac-ggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctctt |
48123584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 5180332 - 5180257
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||||||||||| ||||||| | ||||||||| |||||| |
|
|
| T |
5180332 |
taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctctt |
5180257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 7794681 - 7794606
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||| |||||||||||||||||||| | ||||| ||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
7794681 |
taaccttagcgcaactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctctt |
7794606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 18326994 - 18327069
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || ||||||||||||||| ||| ||||||| |||||| |
|
|
| T |
18326994 |
taaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctctt |
18327069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 343 - 428
Target Start/End: Complemental strand, 27889395 - 27889312
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | ||||| | |||||||||||||||||||| |
|
|
| T |
27889395 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttttta |
27889312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 230
Target Start/End: Complemental strand, 33872070 - 33872009
Alignment:
| Q |
169 |
ctggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
33872070 |
ctggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctctt |
33872009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 42391179 - 42391097
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
42391179 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
42391097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 43557528 - 43557613
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggc-tttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||| |||| ||| ||||||||||| | || |||| ||||||||||||||||||||| |
|
|
| T |
43557528 |
ctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccctttttt |
43557613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 47716515 - 47716596
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | ||||| |||||||||||||||||| |
|
|
| T |
47716515 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttt |
47716596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 1424085 - 1424017
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||| | ||||| ||| |||||||||| |||| |||||||||||| |
|
|
| T |
1424085 |
taactttggcgcaactggtaaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaaca |
1424017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 12473267 - 12473339
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
12473267 |
ccttggcgcaaccggtaaagttgttgtcatgtatctgaaaggtcatgggttcaagtcctgcaaacaacctctt |
12473339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 32758320 - 32758397
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
32758320 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
32758397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 40463836 - 40463892
Alignment:
| Q |
154 |
ataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
40463836 |
ataaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttca |
40463892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 348 - 423
Target Start/End: Complemental strand, 3469251 - 3469176
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||||||| ||||||| | |||||| ||| | ||||||||||| |
|
|
| T |
3469251 |
tacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt |
3469176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 21172088 - 21172008
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
21172088 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21172008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 260
Target Start/End: Complemental strand, 28362316 - 28362214
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgta |
256 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||| |||||| |||| ||||| |||||| | |||||| | ||||||||| |||| |
|
|
| T |
28362316 |
ccttggcgcaac-ggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgta |
28362218 |
T |
 |
| Q |
257 |
caat |
260 |
Q |
| |
|
|||| |
|
|
| T |
28362217 |
caat |
28362214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 260
Target Start/End: Original strand, 16341254 - 16341344
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | || |||||| |||||| | |||||| | ||||||||||||||||||| |
|
|
| T |
16341254 |
ggtaaagttgttatcatgtatttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaat |
16341344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 221
Target Start/End: Complemental strand, 22699145 - 22699079
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaa |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||||||||| | ||||||| ||||||||| |
|
|
| T |
22699145 |
taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaa |
22699079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 343 - 420
Target Start/End: Complemental strand, 33871989 - 33871914
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcc |
420 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||||| ||||||| | |||||| |||||| ||||||| |
|
|
| T |
33871989 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 348 - 425
Target Start/End: Complemental strand, 35787343 - 35787268
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||| | | ||||||||||||| |||| |||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
35787343 |
tacaatacaccaaa--tggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgccctttt |
35787268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 36602535 - 36602585
Alignment:
| Q |
377 |
tcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
36602585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 48735201 - 48735122
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||| |
|
|
| T |
48735201 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
48735122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 344 - 427
Target Start/End: Complemental strand, 38262274 - 38262193
Alignment:
| Q |
344 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| || ||||||||||| | |||||| |||||||| |||||||||||| |
|
|
| T |
38262274 |
tgcatacaatacaccaaa--tgatgggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgccctttttt |
38262193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 45019006 - 45018923
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaa--tagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||| |||||||| | |||| |||||||||| ||||||||||||||| | |||||| |||||| ||||||||||| |
|
|
| T |
45019006 |
ctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 361 - 424
Target Start/End: Complemental strand, 2541082 - 2541019
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||| | |||||| ||||||||||| |||||| |
|
|
| T |
2541082 |
aaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttcccttt |
2541019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 158 - 221
Target Start/End: Original strand, 13805066 - 13805128
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaa |
221 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
13805066 |
ccttggcgcaa-tggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaa |
13805128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 351 - 394
Target Start/End: Original strand, 39123957 - 39124000
Alignment:
| Q |
351 |
aatacaccaaaaatagtgggaccccttcccagaccctgcgtatg |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
39123957 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatg |
39124000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 10693152 - 10693073
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||| |||||||||||| |
|
|
| T |
10693152 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcccttt |
10693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 22699049 - 22698967
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccc-cttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||| ||||| ||||||| ||||||| | ||| || ||||||||||| |||||| |
|
|
| T |
22699049 |
ctgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttacccttt |
22698967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 23419753 - 23419674
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| ||||| ||||| |||| |||||||| |||| |||| |||||||| |
|
|
| T |
23419753 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgcccttt |
23419674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 361 - 427
Target Start/End: Complemental strand, 34626271 - 34626205
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||| | |||||| | || |||||||||||||||| |
|
|
| T |
34626271 |
aaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctttttt |
34626205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 423
Target Start/End: Complemental strand, 11617667 - 11617589
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| |||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
11617667 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 33500569 - 33500622
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
396 |
Q |
| |
|
|||| ||| |||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33500569 |
ctgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcg |
33500622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 228
Target Start/End: Complemental strand, 34626382 - 34626309
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| ||||||| ||| | |||| ||||||||||| |||| |
|
|
| T |
34626382 |
taaccttagcgcaactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctc |
34626309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 18512511 - 18512455
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
18512511 |
gtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 28078306 - 28078238
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
||||| |||||||||| || |||||||| ||||||| ||| ||||||||||||||| |||| |||||| |
|
|
| T |
28078306 |
taaccctggcgcaactcgtgaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaaca |
28078238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 29140531 - 29140487
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcac |
203 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
29140531 |
cttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcac |
29140487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 361 - 425
Target Start/End: Complemental strand, 31591172 - 31591108
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||||| |||| ||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
31591172 |
aaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgccctttt |
31591108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 35334874 - 35334818
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| ||||||||||| |||| |
|
|
| T |
35334874 |
gtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 361 - 425
Target Start/End: Original strand, 40463948 - 40464012
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
40463948 |
aaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctttt |
40464012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 42476833 - 42476901
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||| |||||| |||||||||||||||| ||||||| || ||||||||||| |||| | ||||||||| |
|
|
| T |
42476833 |
taacattggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaaca |
42476901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 42798725 - 42798806
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| ||||| |||||||| |||||| | ||| || |||| ||||||||||||||| |
|
|
| T |
42798725 |
ctgcgtacaatacaccaaa--tggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcccttttt |
42798806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 238
Target Start/End: Original strand, 6736867 - 6736934
Alignment:
| Q |
172 |
gtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaa |
238 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
6736867 |
gtaaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaa |
6736934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 210
Target Start/End: Original strand, 19265781 - 19265830
Alignment:
| Q |
160 |
ttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||| |||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
19265781 |
ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttca |
19265830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 373 - 427
Target Start/End: Original strand, 25198810 - 25198864
Alignment:
| Q |
373 |
cccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| |||||| | | |||||| ||||||||||||| ||||||| |
|
|
| T |
25198810 |
cccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcactttttt |
25198864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 29907393 - 29907454
Alignment:
| Q |
171 |
ggtaaagttgtt--atcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
29907393 |
ggtaaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctctt |
29907454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 350 - 423
Target Start/End: Original strand, 29907482 - 29907552
Alignment:
| Q |
350 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
||||||||||||| | |||||||||| |||| ||||||| |||||| | |||||| ||||||||||||||||| |
|
|
| T |
29907482 |
caatacaccaaaa-tggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 223
Target Start/End: Complemental strand, 42391251 - 42391205
Alignment:
| Q |
177 |
gttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42391251 |
gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaaca |
42391205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 3469350 - 3469306
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcac |
203 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
3469350 |
ccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcac |
3469306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 18747564 - 18747621
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||| ||||||||| ||||||| |
|
|
| T |
18747564 |
gtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 19426968 - 19426887
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| ||| | |||||||| |||||| | |||| | ||||||||||||||||||||| |
|
|
| T |
19426968 |
ctgcgtacaatacaccaaa--tggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttgccctttttt |
19426887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 361 - 426
Target Start/End: Complemental strand, 23619040 - 23618975
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||| |||||| ||||| ||| | |||||| |||| ||||||||||||||| |
|
|
| T |
23619040 |
aaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttttt |
23618975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 361 - 426
Target Start/End: Original strand, 27629706 - 27629771
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||||| | |||||| |||||| |||| | |||||||||||||||||||| |
|
|
| T |
27629706 |
aaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcccttttt |
27629771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 2e-24; HSPs: 77)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 8247864 - 8247758
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| | |||||| | |||||||| | | |
|
|
| T |
8247864 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgc |
8247765 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
8247764 |
gtacaat |
8247758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 29366897 - 29366791
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| || |||||||||||||||| ||||||||||| |||||| |||||||| | |||||||||| | |
|
|
| T |
29366897 |
taaccttggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgc |
29366798 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
29366797 |
gtacaat |
29366791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 40272987 - 40272881
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||| ||||||| |||||||||||||||||| | |||||| | |||||||||| | |
|
|
| T |
40272987 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
40272888 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
40272887 |
gtacaat |
40272881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 46421212 - 46421106
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
46421212 |
taaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
46421113 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
46421112 |
gtacaat |
46421106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 10870126 - 10870051
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
10870126 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
10870051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 13628871 - 13628789
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
13628871 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
13628789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 13730779 - 13730673
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| |
|
|
| T |
13730779 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgt |
13730680 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
13730679 |
gtacaat |
13730673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 343 - 429
Target Start/End: Complemental strand, 40272891 - 40272807
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
429 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
40272891 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttat |
40272807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 52926385 - 52926310
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
52926385 |
taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctt |
52926310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 344 - 426
Target Start/End: Complemental strand, 5173799 - 5173717
Alignment:
| Q |
344 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||| ||||||||||||||| ||||| ||||||||| |||| |||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
5173799 |
tgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcccttttt |
5173717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 45786295 - 45786214
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||| |||| | |||||| |||||||||||||||||| |
|
|
| T |
45786295 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgcccttt |
45786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 46421116 - 46421031
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | ||||||| |||||||| |||||||||||| |
|
|
| T |
46421116 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccctttttt |
46421031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 5173896 - 5173820
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaa-gttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||| ||||| |||||| ||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5173896 |
taaccttggcgcaactcgtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctctt |
5173820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 7697060 - 7696992
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
7697060 |
taaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaaca |
7696992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 54484769 - 54484850
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
54484769 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
54484850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 1217072 - 1217147
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
1217072 |
taaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctctt |
1217147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 13628968 - 13628861
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaa-gttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggcta |
252 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| | ||| || | |||||||||| |
|
|
| T |
13628968 |
taaccttggcacaactggtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctg |
13628869 |
T |
 |
| Q |
253 |
cgtacaat |
260 |
Q |
| |
|
|||||||| |
|
|
| T |
13628868 |
cgtacaat |
13628861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 348 - 427
Target Start/End: Complemental strand, 13730678 - 13730599
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
13730678 |
tacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
13730599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 16735423 - 16735528
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| || |||||||||||| |||| |||||| |||||| || ||||| | |||||||||| | |
|
|
| T |
16735423 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgc |
16735521 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
16735522 |
gtacaat |
16735528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 29366801 - 29366719
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||| | | |||||| ||||| ||||||||||||| |
|
|
| T |
29366801 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccctttt |
29366719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 10795504 - 10795423
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||||||||||||| | |||| | |||||| ||||||||||| |
|
|
| T |
10795504 |
ctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgcccttt |
10795423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 343 - 428
Target Start/End: Complemental strand, 49013554 - 49013469
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || || ||| | |||||| |||||||||||||||||||||| |
|
|
| T |
49013554 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgccctttttta |
49013469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 35417902 - 35417973
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| |||||||| ||||| |||||||||||| |||||| |
|
|
| T |
35417902 |
ccttggcgcaac-ggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctctt |
35417973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 343 - 422
Target Start/End: Complemental strand, 353430 - 353351
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||| |
|
|
| T |
353430 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 359 - 426
Target Start/End: Original strand, 516504 - 516571
Alignment:
| Q |
359 |
aaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
516504 |
aaaaatggcgggaccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
516571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 9607185 - 9607260
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
9607185 |
taaccttggcgcaacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctctt |
9607260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 260
Target Start/End: Original strand, 26573113 - 26573215
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacct-ctttataaaaagcggggtaaggctacgta |
256 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||| ||||||||||||||||||| ||||||||||| ||| || | |||||| | |||||||||| |||| |
|
|
| T |
26573113 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgta |
26573211 |
T |
 |
| Q |
257 |
caat |
260 |
Q |
| |
|
|||| |
|
|
| T |
26573212 |
caat |
26573215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 162 - 229
Target Start/End: Original strand, 26869696 - 26869763
Alignment:
| Q |
162 |
ggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctct |
229 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||| |||||| ||||||||||| ||||| |
|
|
| T |
26869696 |
ggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctct |
26869763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 4495839 - 4495733
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||| ||| | ||| || | |||||| | |||||||||| | |
|
|
| T |
4495839 |
taaccttcgcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaaggctgc |
4495740 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
4495739 |
gtacaat |
4495733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 348 - 425
Target Start/End: Complemental strand, 12914109 - 12914034
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||||| |||||| | |||| ||||||||||||||||||||| |
|
|
| T |
12914109 |
tacaatacaccaaa--tggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctttt |
12914034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 12914210 - 12914104
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| | |||||||||| ||||| ||||||||||| |||||| | |||||| | ||||||||| | |
|
|
| T |
12914210 |
taaccttggcgcaactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcggc |
12914111 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
12914110 |
gtacaat |
12914104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 45139557 - 45139505
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
45139557 |
ctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcg |
45139505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 52926298 - 52926216
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
52926298 |
ctgcgtacaatacaccaaa--tggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttttt |
52926216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 348 - 427
Target Start/End: Complemental strand, 8247763 - 8247683
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||| ||||||||||||||| | ||||||| ||||| |||||||||| |||| |
|
|
| T |
8247763 |
tacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccctatttt |
8247683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 22123090 - 22123022
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||||||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
22123090 |
taaccttggcgccactggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaaca |
22123022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 158 - 257
Target Start/End: Complemental strand, 34420815 - 34420716
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgta |
256 |
Q |
| |
|
|||||||||||| | |||||||||| ||| ||| ||||||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| |||| |
|
|
| T |
34420815 |
ccttggcgcaacag-taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgta |
34420717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 289 - 344
Target Start/End: Complemental strand, 9144865 - 9144810
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
344 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9144865 |
tggcccatttctataggcaggcctctcgggctcgggccggcccatttgacacctct |
9144810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 429
Target Start/End: Original strand, 15797298 - 15797382
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
429 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||| | | ||| || ||||||||||||||||||||||| |
|
|
| T |
15797298 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttttttat |
15797382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 25517249 - 25517169
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||||||||| || ||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
25517249 |
ctgcgtacaatacac--aaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttt |
25517169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 39203498 - 39203573
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||||||| |||||||||||| |||||| |||| |||||| |||||| |
|
|
| T |
39203498 |
taaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctctt |
39203573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 53996645 - 53996563
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||| ||| ||||||||| | | |||||| ||||||||| |||||||||| |
|
|
| T |
53996645 |
ctgcttacaatacaccaaaa-tggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttttt |
53996563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 22609749 - 22609853
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||| ||||| ||||||||| || |||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
22609749 |
taaccttggcgcaac-ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
22609846 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
22609847 |
gtacaat |
22609853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 361 - 427
Target Start/End: Complemental strand, 24851364 - 24851298
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| || ||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
24851364 |
aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttttt |
24851298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 25517350 - 25517300
Alignment:
| Q |
153 |
gataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
25517350 |
gataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcac |
25517300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 14987035 - 14987116
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||| ||||| |||| ||| |||||| | |||||| ||||||||||| |||||| |
|
|
| T |
14987035 |
ctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 423
Target Start/End: Complemental strand, 22122996 - 22122918
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||| |
|
|
| T |
22122996 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 423
Target Start/End: Original strand, 22609843 - 22609921
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| |||||||||| | |||| | ||||||||||||||||| |
|
|
| T |
22609843 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 26869784 - 26869866
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||| || |||| |||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
26869784 |
ctgcgtacaatacaccaaa--tggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctttttt |
26869866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 348 - 424
Target Start/End: Original strand, 39203597 - 39203671
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||| ||| |||||| | |||||| |||||||||||||||||| |
|
|
| T |
39203597 |
tacaatacaccaaa--tggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttt |
39203671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 1217166 - 1217247
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | | ||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
1217166 |
ctgcgtacaatacaccaaa--tggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
1217247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 369 - 425
Target Start/End: Complemental strand, 10484671 - 10484615
Alignment:
| Q |
369 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10484615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 34771443 - 34771362
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||| |||||||||| |
|
|
| T |
34771443 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttttt |
34771362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 45621000 - 45620929
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||| ||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
45621000 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctctt |
45620929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 289 - 344
Target Start/End: Complemental strand, 50462768 - 50462708
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
344 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50462768 |
tggcccatttctatagtcgggcctctcgggcttgggccgggccggcccatttgacacctct |
50462708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 155 - 251
Target Start/End: Original strand, 12525392 - 12525486
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggct |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || |||||||||||| ||||| ||||||||||| |||||| | |||||| | |||||||||| |
|
|
| T |
12525392 |
taaccttggcgcaactggtaaagttg---tcatatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggtaaggct |
12525486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 25944552 - 25944630
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||||||||||||| | | |||||| ||||| || ||||||||||| |
|
|
| T |
25944552 |
tacaatacaccaaaa-tggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccctttttt |
25944630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 366 - 425
Target Start/End: Original strand, 30452894 - 30452953
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
30452894 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30452953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 376 - 427
Target Start/End: Original strand, 47624208 - 47624259
Alignment:
| Q |
376 |
ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
47624259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 4495718 - 4495672
Alignment:
| Q |
382 |
gaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
4495718 |
gaccctgcgtatgcgggagctttagtgcaccgggttgccctttttta |
4495672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 6411996 - 6411891
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| |||| |||||| ||||||| || || ||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
6411996 |
taaccttgacgcaactggtaaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaa-cagggtaaggctgc |
6411898 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
6411897 |
gtacaat |
6411891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 31592925 - 31593004
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||| |||||||| |||||| | ||| || |||||||||||||||||| |
|
|
| T |
31592925 |
ctgcgtacaatacaccaaa--tggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 260
Target Start/End: Original strand, 516420 - 516497
Alignment:
| Q |
184 |
tcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| |||||| | |||||| | |||||||||| || ||||| |
|
|
| T |
516420 |
tcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaat |
516497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 292 - 344
Target Start/End: Complemental strand, 29322878 - 29322821
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
344 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29322878 |
cccatttctatagtcgggcctctcgggcttgggccgggccggcccatttgacacctct |
29322821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 45949012 - 45948938
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaa---aggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
45949012 |
ccttggcgcaac-ggtgaagttgttttcatgtgactgaaggaaggtcacgggttcaattcctggaaacaacctctt |
45948938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 228
Target Start/End: Original strand, 53062036 - 53062093
Alignment:
| Q |
171 |
ggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctc |
228 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
53062036 |
ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctc |
53062093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 260
Target Start/End: Complemental strand, 54032705 - 54032628
Alignment:
| Q |
184 |
tcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
260 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||||||||||||||||| | |||||| | |||||||||| | |||||| |
|
|
| T |
54032705 |
tcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaat |
54032628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 348 - 428
Target Start/End: Complemental strand, 829517 - 829438
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||||||||||||| | |||||| |||||||| || ||||||||| |
|
|
| T |
829517 |
tacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccggtctgtcctttttta |
829438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 40390357 - 40390401
Alignment:
| Q |
383 |
accctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
40390357 |
accctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
40390401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 414
Target Start/End: Complemental strand, 45948917 - 45948848
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgg |
414 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| | ||||||||||||||| | |||||| |||||||| |
|
|
| T |
45948917 |
ctgcatacaatacaccaat--tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 343 - 413
Target Start/End: Complemental strand, 6411901 - 6411833
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccg |
413 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||| |||||||||| | |||||| ||||||| |
|
|
| T |
6411901 |
ctgcgtacaatacaccaaa--tgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 343 - 425
Target Start/End: Original strand, 16735518 - 16735598
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||| ||||||||||| |||| | ||||| ||||||||||||| |
|
|
| T |
16735518 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttt |
16735598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 230
Target Start/End: Complemental strand, 30928302 - 30928247
Alignment:
| Q |
175 |
aagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
30928302 |
aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
30928247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 260
Target Start/End: Complemental strand, 53996737 - 53996635
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgta |
256 |
Q |
| |
|
||||||||| || |||||| ||||| |||| || ||||||||||||| ||||| || ||||||||||||||| | |||||| | |||||||||| | || |
|
|
| T |
53996737 |
ccttggcgctac-ggtaaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgctta |
53996639 |
T |
 |
| Q |
257 |
caat |
260 |
Q |
| |
|
|||| |
|
|
| T |
53996638 |
caat |
53996635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 382 - 425
Target Start/End: Complemental strand, 54032613 - 54032570
Alignment:
| Q |
382 |
gaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
54032613 |
gaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
54032570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 353 - 427
Target Start/End: Original strand, 12525493 - 12525567
Alignment:
| Q |
353 |
tacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||| ||||||| |||||| |||||||| |||| || | |||| | |||||| |||||| ||||||| |
|
|
| T |
12525493 |
tacaccaaaaatggtgggacaccttcctagaccctgtgtatacgggagcttcactgcaccaggttgctctttttt |
12525567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 429
Target Start/End: Complemental strand, 54374425 - 54374340
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
429 |
Q |
| |
|
|||| |||||| |||||||| | ||||||||||||||| |||||||| |||||| | |||||| | |||| || |||| |||||||| |
|
|
| T |
54374425 |
ctgcgtacaatccaccaaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagttcaccaggctgccattttttat |
54374340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 366 - 427
Target Start/End: Original strand, 26573226 - 26573287
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| | |||||| |||||| || |||||| |||| |
|
|
| T |
26573226 |
gtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccctctttt |
26573287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 6e-24; HSPs: 46)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 340 - 425
Target Start/End: Original strand, 12885964 - 12886049
Alignment:
| Q |
340 |
cctctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||||||||||||||||||||||| | | |||||| ||||||||||||||||||| |
|
|
| T |
12885964 |
cctctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttt |
12886049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 343 - 426
Target Start/End: Complemental strand, 29355936 - 29355853
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
29355936 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
29355853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 159 - 260
Target Start/End: Complemental strand, 12222088 - 12221986
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtac |
257 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||| || |||||||| |||||| | |||||| | |||||||||| ||||| |
|
|
| T |
12222088 |
cttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtac |
12221989 |
T |
 |
| Q |
258 |
aat |
260 |
Q |
| |
|
||| |
|
|
| T |
12221988 |
aat |
12221986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 1346924 - 1346992
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
1346924 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaaca |
1346992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 1354930 - 1354855
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
1354930 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctctt |
1354855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 8409203 - 8409309
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| |||||||||||||| |||| |||||||||| |||||| | |||||| | |||||||||| | |
|
|
| T |
8409203 |
taaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggtaaggctgc |
8409302 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
8409303 |
gtacaat |
8409309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 3815252 - 3815184
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3815252 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaaca |
3815184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 12221996 - 12221913
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggc-tttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | || |||| ||||||||||||||||||| |
|
|
| T |
12221996 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 147 - 230
Target Start/End: Complemental strand, 14975263 - 14975180
Alignment:
| Q |
147 |
atgagagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||| ||||||| ||| |||||||||| |||| ||||||||||| |||||| |
|
|
| T |
14975263 |
atgagggataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctctt |
14975180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 149 - 230
Target Start/End: Original strand, 24734587 - 24734668
Alignment:
| Q |
149 |
gagagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| ||||||| ||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
24734587 |
gagaggtaacattggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaaaagttcaaatccttgaaacaacctctt |
24734668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 351 - 427
Target Start/End: Original strand, 12892071 - 12892147
Alignment:
| Q |
351 |
aatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
12892071 |
aatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
12892147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 163 - 230
Target Start/End: Complemental strand, 2166579 - 2166512
Alignment:
| Q |
163 |
gcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2166579 |
gcgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctctt |
2166512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 163 - 230
Target Start/End: Complemental strand, 2178212 - 2178145
Alignment:
| Q |
163 |
gcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2178212 |
gcgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctctt |
2178145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 260
Target Start/End: Complemental strand, 29356033 - 29355926
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaag-ttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggcta |
252 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| | ||| || | |||||||||| |
|
|
| T |
29356033 |
taaccttggcacaactggtaaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctg |
29355934 |
T |
 |
| Q |
253 |
cgtacaat |
260 |
Q |
| |
|
|||||||| |
|
|
| T |
29355933 |
cgtacaat |
29355926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 349 - 427
Target Start/End: Complemental strand, 3116204 - 3116126
Alignment:
| Q |
349 |
acaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | |||| |||||||||| | |||||| | |||||| |||||||||||| |
|
|
| T |
3116204 |
acaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccctttttt |
3116126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 156 - 261
Target Start/End: Complemental strand, 13905152 - 13905047
Alignment:
| Q |
156 |
aaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacg |
254 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||||||||||| ||| ||||| |||| ||||||| | |||||| | |||||||||| | |
|
|
| T |
13905152 |
aaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaaggctgca |
13905054 |
T |
 |
| Q |
255 |
tacaatt |
261 |
Q |
| |
|
||||||| |
|
|
| T |
13905053 |
tacaatt |
13905047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 1347018 - 1347100
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
1347018 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
1347100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 348 - 428
Target Start/End: Complemental strand, 2166486 - 2166406
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||| ||| || | |||||| |||||||||||||||||||||| |
|
|
| T |
2166486 |
tacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttttta |
2166406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 348 - 428
Target Start/End: Complemental strand, 2178119 - 2178039
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||| ||| || | |||||| |||||||||||||||||||||| |
|
|
| T |
2178119 |
tacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttttta |
2178039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 366 - 426
Target Start/End: Original strand, 6808472 - 6808532
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
6808472 |
gtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttttt |
6808532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 343 - 427
Target Start/End: Original strand, 9161178 - 9161262
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||| ||| ||| ||||||||||||| | ||||||||||||||| |||||| |||||| |||||||||||||| |
|
|
| T |
9161178 |
ctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctttttt |
9161262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 12063427 - 12063511
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaa |
238 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| | ||||||||||||||||||| |||| |||| | |||||| |||||||| |
|
|
| T |
12063427 |
taaccttggtgcaactgataaagttgttatcatgagactgaaaggtcacgggttcaagtcctagaaatagcctcttgtataaaaa |
12063511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 1354836 - 1354756
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
1354836 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1354756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 9161083 - 9161158
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||| |||||||||||| ||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
9161083 |
taaccttgacgcaatcggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctt |
9161158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 15866212 - 15866137
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||| |||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
15866212 |
taaccttggcccaactggtaaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctctt |
15866137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 258
Target Start/End: Original strand, 20400621 - 20400731
Alignment:
| Q |
149 |
gagagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaa |
247 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||| ||||||| |||||||||||| |||||| | ||||||||| ||||| | |||||| | |||||| |
|
|
| T |
20400621 |
gagaggtaaccttggcgcaattggtatagttgttgtcatgtgactgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaa |
20400720 |
T |
 |
| Q |
248 |
ggctacgtaca |
258 |
Q |
| |
|
| || |||||| |
|
|
| T |
20400721 |
gactgcgtaca |
20400731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 348 - 424
Target Start/End: Complemental strand, 383834 - 383760
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||||||||||| | |||| | | |||||||||||||||| |
|
|
| T |
383834 |
tacaatacaccaaa--ttgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt |
383760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 361 - 426
Target Start/End: Original strand, 13267797 - 13267862
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| | |||| | |||||||||||||||||||| |
|
|
| T |
13267797 |
aaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttttt |
13267862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 1941815 - 1941921
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| || ||| |||||| ||| || | || || |||||||||||| | |||||| | |||||||||| | |
|
|
| T |
1941815 |
taaccttggtgcaactggtaaagttgttgtcatctgactggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaaggctgc |
1941914 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
1941915 |
gtacaat |
1941921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 230
Target Start/End: Original strand, 6024202 - 6024268
Alignment:
| Q |
164 |
cgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||| ||||||| || |||||||||| |||| ||||| |||||| |||||| |
|
|
| T |
6024202 |
cgcaactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctctt |
6024268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 361 - 427
Target Start/End: Complemental strand, 18277256 - 18277190
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| |||| || |||||||| | |||||| |||||||||||| |||||||| |
|
|
| T |
18277256 |
aaatggtgggaccccttcctagactctacgtatgcgggagctttactgcaccgggttgtcctttttt |
18277190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 368 - 426
Target Start/End: Original strand, 26097237 - 26097295
Alignment:
| Q |
368 |
gggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
26097237 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
26097295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 343 - 423
Target Start/End: Complemental strand, 2755503 - 2755422
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgg--gctttaatgcaccgggttgccctt |
423 |
Q |
| |
|
|||| ||||||||||||||||| |||||| |||||||| | ||||| ||||||||| |||||| |||||| |||||||||| |
|
|
| T |
2755503 |
ctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt |
2755422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 289 - 328
Target Start/End: Original strand, 2979117 - 2979156
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
328 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2979117 |
tggcccatttctatagtcgggcctctcgggctcgggccgg |
2979156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 260
Target Start/End: Complemental strand, 7947543 - 7947441
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacct-ctttataaaaagcggggtaaggctacgta |
256 |
Q |
| |
|
|||||||||||| |||||||||| | | ||| |||||||||||| |||||| ||||||||||||||| || | |||||| | |||||||||| |||| |
|
|
| T |
7947543 |
ccttggcgcaac-ggtaaagttggtgttgcgtgactgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgta |
7947445 |
T |
 |
| Q |
257 |
caat |
260 |
Q |
| |
|
|||| |
|
|
| T |
7947444 |
caat |
7947441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 289 - 328
Target Start/End: Complemental strand, 21038362 - 21038323
Alignment:
| Q |
289 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
328 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
21038362 |
tggcccatttctatagtcgggcctctcgggcccgagccgg |
21038323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 366 - 425
Target Start/End: Complemental strand, 23930185 - 23930126
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
||||||||||||| | |||||||| |||||| | |||||| ||||||| ||||||||||| |
|
|
| T |
23930185 |
gtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttt |
23930126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 428
Target Start/End: Original strand, 24097649 - 24097716
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||| || || ||||||||||||||| |
|
|
| T |
24097649 |
aaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgccctttttta |
24097716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 371 - 426
Target Start/End: Original strand, 25557805 - 25557860
Alignment:
| Q |
371 |
accccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
25557805 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
25557860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 33923003 - 33922948
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| || |||||| ||||| |||||| |
|
|
| T |
33923003 |
taaccttggcgcaaccggtaaagttgttgtcatttgactgaaaagtcacaggttca |
33922948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 8417442 - 8417500
Alignment:
| Q |
165 |
gcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| |||||| ||||| || |||||||| |
|
|
| T |
8417442 |
gcaactggtaaagttgttgtcatgtgactgaaatgtcacgagttcaggtcatggaaaca |
8417500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 366 - 424
Target Start/End: Complemental strand, 10734963 - 10734905
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| | |||||| | ||||||| |||||||| |
|
|
| T |
10734963 |
gtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt |
10734905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 350 - 420
Target Start/End: Complemental strand, 14975164 - 14975094
Alignment:
| Q |
350 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcc |
420 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||| || |||||| | | |||| |||||||||||||| |
|
|
| T |
14975164 |
caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 19649338 - 19649292
Alignment:
| Q |
159 |
cttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgg |
205 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| ||||||| |||||| |
|
|
| T |
19649338 |
cttggcgcaactgataaagttgttgtcatgtgactgaaagatcacgg |
19649292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 259 - 296
Target Start/End: Original strand, 2978549 - 2978586
Alignment:
| Q |
259 |
attagagctgtcaaaaatgagccggtccattggcccat |
296 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
2978549 |
attagagctgtcaaaaatgggccggtccattgtcccat |
2978586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 221
Target Start/End: Original strand, 14553477 - 14553537
Alignment:
| Q |
160 |
ttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaa |
221 |
Q |
| |
|
|||| |||||||||||||||||| ||||||| || ||||||||| |||||| ||||||||| |
|
|
| T |
14553477 |
ttggtgcaactggtaaagttgttgtcatgtgact-aaaggtcacaggttcaagtcctggaaa |
14553537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 54; Significance: 2e-21; HSPs: 2)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 59033 - 59114
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| ||||||||||| | |||||| |||| ||||||||||||| |
|
|
| T |
59033 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcccttt |
59114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049; HSP #2
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 58937 - 59043
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctac |
253 |
Q |
| |
|
||||||||| |||||||||||| || || ||||||| ||||||||||||||||||| ||||||||||| |||||| |||||||| | ||||||| || | |
|
|
| T |
58937 |
taaccttggagcaactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgc |
59036 |
T |
 |
| Q |
254 |
gtacaat |
260 |
Q |
| |
|
||||||| |
|
|
| T |
59037 |
gtacaat |
59043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 53; Significance: 6e-21; HSPs: 2)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 366 - 426
Target Start/End: Complemental strand, 13082 - 13022
Alignment:
| Q |
366 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
13082 |
gtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcccttttt |
13022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258; HSP #2
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 13198 - 13123
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
13198 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctctt |
13123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 52; Significance: 2e-20; HSPs: 6)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 10223 - 10148
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
10223 |
taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
10148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 20551 - 20476
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
20551 |
taaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
20476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 422
Target Start/End: Complemental strand, 10129 - 10052
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |||||||| ||||| | ||| | |||||||||||||||| |
|
|
| T |
10129 |
ctgcgtacaatacaccaaa--tagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #4
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 343 - 422
Target Start/End: Complemental strand, 20457 - 20380
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
422 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |||||||| ||||| | ||| | |||||||||||||||| |
|
|
| T |
20457 |
ctgcgtacaatacaccaaa--tagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 8905 - 8960
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
||||||||||||||| ||| |||||||| ||||||| |||||| ||||| |||||| |
|
|
| T |
8905 |
taaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttca |
8960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 19233 - 19288
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
||||||||||||||| ||| |||||||| ||||||| |||||| ||||| |||||| |
|
|
| T |
19233 |
taaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttca |
19288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 30539 - 30614
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
30539 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctctt |
30614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168; HSP #2
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 343 - 426
Target Start/End: Original strand, 30633 - 30714
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
426 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
30633 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
30714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 49; Significance: 1e-18; HSPs: 5)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 348 - 427
Target Start/End: Original strand, 46892 - 46969
Alignment:
| Q |
348 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
46892 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
46969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 344 - 428
Target Start/End: Complemental strand, 46786 - 46703
Alignment:
| Q |
344 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
428 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||||||||||||| | ||||||||||| | || ||||| |||||| |
|
|
| T |
46786 |
tgcatacaatataccaaaa-tggtgggaccccttcccagaccctgcgtatgcgggagctttaatgcatcaggctgcccattttta |
46703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 24942 - 24887
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
24942 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttca |
24887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 46794 - 46866
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| || ||||||||||||||| | |||||||||||||||| |
|
|
| T |
46794 |
ccttggcgcaattggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctctt |
46866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #5
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 361 - 427
Target Start/End: Complemental strand, 24835 - 24769
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| | |||||| |||| | |||||||||||||| |
|
|
| T |
24835 |
aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgccctttttt |
24769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 48; Significance: 6e-18; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 226581 - 226506
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||| |||| |||| |||||| |||||| |
|
|
| T |
226581 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctctt |
226506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 47; Significance: 2e-17; HSPs: 2)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 156 - 230
Target Start/End: Original strand, 11093 - 11166
Alignment:
| Q |
156 |
aaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
11093 |
aaccttggcgcaactggtaaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctctt |
11166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223; HSP #2
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 424
Target Start/End: Original strand, 11185 - 11264
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||| |||||||| |||||| | ||| || |||||| ||||||||||| |
|
|
| T |
11185 |
ctgcttacaatacaccaaa--tggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcccttt |
11264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 146 - 224
Target Start/End: Original strand, 83826 - 83904
Alignment:
| Q |
146 |
catgagagataaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaa |
224 |
Q |
| |
|
|||||| | |||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
83826 |
catgaggggtaaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaa |
83904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 163 - 230
Target Start/End: Original strand, 4125 - 4192
Alignment:
| Q |
163 |
gcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||| ||||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4125 |
gcgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctctt |
4192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 230
Target Start/End: Complemental strand, 1758 - 1685
Alignment:
| Q |
157 |
accttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||| ||||| ||||||||||||| ||||||| ||||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
1758 |
accttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctctt |
1685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 343 - 420
Target Start/End: Complemental strand, 1666 - 1591
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcc |
420 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| ||||| ||||||||| | |||||| |||||| ||||||| |
|
|
| T |
1666 |
ctgcatacaatacaccaaa--tgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 343 - 425
Target Start/End: Complemental strand, 48713 - 48633
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
48713 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
48633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 343 - 427
Target Start/End: Complemental strand, 24212 - 24130
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
427 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||| |||||||||||| |
|
|
| T |
24212 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttttt |
24130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 10773 - 10825
Alignment:
| Q |
158 |
ccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttca |
210 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
10773 |
ccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttca |
10825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 361 - 425
Target Start/End: Original strand, 10882 - 10946
Alignment:
| Q |
361 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
425 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| ||||| ||||||| ||||| |
|
|
| T |
10882 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgctctttt |
10946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 230
Target Start/End: Original strand, 8865 - 8926
Alignment:
| Q |
169 |
ctggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||| |||||| ||||||||||||| |||| |
|
|
| T |
8865 |
ctggtaaagttgttgtcatgtgactgtaaggtcacaggttcaattcctggaaacaacttctt |
8926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 24624 - 24692
Alignment:
| Q |
155 |
taaccttggcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaaca |
223 |
Q |
| |
|
|||||||||| ||| || |||||||||| ||| ||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
24624 |
taaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaaca |
24692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 230
Target Start/End: Original strand, 43097 - 43164
Alignment:
| Q |
163 |
gcgcaactggtaaagttgttatcatgtggctgaaaggtcacgggttcatatcctggaaacaacctctt |
230 |
Q |
| |
|
||||||||||||||||| || ||||||| |||||||||||| ||||| |||| |||||| |||||| |
|
|
| T |
43097 |
gcgcaactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctctt |
43164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 31; Significance: 0.00000008; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 72946 - 72867
Alignment:
| Q |
343 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
424 |
Q |
| |
|
|||| |||||||||||||| | || | |||||||||| || |||||||||||| | |||||| |||||| ||||||||||| |
|
|
| T |
72946 |
ctgcctacaatacaccaaa--tggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 190
Target Start/End: Complemental strand, 73034 - 73001
Alignment:
| Q |
157 |
accttggcgcaactggtaaagttgttatcatgtg |
190 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
73034 |
accttggcgcaactggtaaagttgttgtcatgtg |
73001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 292 - 344
Target Start/End: Original strand, 4232 - 4289
Alignment:
| Q |
292 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
344 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4232 |
cccatttctatagtcgggcttctcgggcccgggctgggccggcccatttgacacctct |
4289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University