View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4604_high_2 (Length: 254)
Name: NF4604_high_2
Description: NF4604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4604_high_2 |
 |  |
|
| [»] scaffold0767 (1 HSPs) |
 |  |  |
|
| [»] scaffold0758 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0767 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0767
Description:
Target: scaffold0767; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 2574 - 2327
Alignment:
| Q |
1 |
tcggttattcaagtatattcctacnnnnnnnattctataattaaatctttttattattacatggtcgattaagnnnnnnnn-gaaagaactggtcatgaa |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2574 |
tcggttattcaagtatattcctactttttttattctataattaaatctttttattattacatggtcgattaagtttttttttgaaagaactggtcatgaa |
2475 |
T |
 |
| Q |
100 |
agaaggacgtattgtagggtttggagggaaccaacaaagaaagattgttggatcatgaactattgttaactctactatctctataataatgtttggtttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2474 |
agaaggacgtattgtagggtttggagggaaccaacaaagaaagattgttgcatcatgaactattgttaactctactatctctataataatgtttggtttg |
2375 |
T |
 |
| Q |
200 |
ttgatggtgaagcacataactttaggctccgtatgtttttgatgatgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2374 |
ttgatggtgaagcacataactttaggctccgtatgtttttgatgatgt |
2327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0758 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0758
Description:
Target: scaffold0758; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 2112 - 2059
Alignment:
| Q |
154 |
atgaactattgttaactctactatctcta-taataatgtttggtttgttgatgg |
206 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2112 |
atgaactattggtaactcttctatctctattaataatgtgtggtttgttgatgg |
2059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 22674415 - 22674364
Alignment:
| Q |
156 |
gaactattgttaactctactatctctat-aataatgtttggtttgttgatgg |
206 |
Q |
| |
|
||||||||| ||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
22674415 |
gaactattgataactcttctatctctattaataatgtgtggtttgttgatgg |
22674364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 73
Target Start/End: Original strand, 46977308 - 46977338
Alignment:
| Q |
43 |
aaatctttttattattacatggtcgattaag |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46977308 |
aaatctttttattattacatggtcgattaag |
46977338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 16111070 - 16111123
Alignment:
| Q |
154 |
atgaactattgttaactctactatctctat-aataatgtttggtttgttgatgg |
206 |
Q |
| |
|
||||||||||| |||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
16111070 |
atgaactattggcaactcttctatctctattaataatgtgtggtttgttgatgg |
16111123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University