View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4605-Insertion-11 (Length: 217)
Name: NF4605-Insertion-11
Description: NF4605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4605-Insertion-11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 6 - 187
Target Start/End: Complemental strand, 44000917 - 44000736
Alignment:
| Q |
6 |
caacaacaacaacggttaccaaacaaatggtgcatatgaaaagtcatttttcacattgataagttttgtttcttttttatcactaaatcattacaagaac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44000917 |
caacaacaacaacggttaccaaacaaatggtgcatatgaaaaatcatttttcacattgataagttttgtttcttttttatcactaaatcattacaagaac |
44000818 |
T |
 |
| Q |
106 |
aagaaacaccgagaggcaatcacattcacgtgctctcatcatggcagctcgcacactttctcgtttgctctctcgctcccta |
187 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44000817 |
aagaaacaccgacaggcaatcacattcacgtgctctcatcatggcagctcgcacactttctcgtttgctctctcgctcccta |
44000736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University