View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4605-Insertion-13 (Length: 125)
Name: NF4605-Insertion-13
Description: NF4605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4605-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 9e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 9e-34
Query Start/End: Original strand, 49 - 125
Target Start/End: Complemental strand, 6049885 - 6049809
Alignment:
| Q |
49 |
ggaaacaagtattgtgggtaagaagtattaggtaaacagtcatatagaaaatgataggtagctatcgaggcttcaca |
125 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6049885 |
ggaaacaagtgttgtgggtaagaagtattaggtaaacagtcatatagaaaatgataggtagctatcgaggcttcaca |
6049809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University