View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4605_low_4 (Length: 337)
Name: NF4605_low_4
Description: NF4605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4605_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 48430738 - 48430434
Alignment:
| Q |
19 |
tttctatatcatagtctttgtaacctgggttgtaggcgtttccaaattgatgaagaagagtaggcaagtttttctggaaatcttaacaaagtttatggag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48430738 |
tttctatatcatagtctttgtaacctgggttgtacgcgtttccaaattga---agaagagcaggcaagtttttctggaaatcttaacaaagtttatggag |
48430642 |
T |
|
| Q |
119 |
ctttatcaatgcttttgattcaattttctctgtgcatatttgaattcttcaacatcaacaggtggccaggggaaaggcaattttggctagtgcaagggaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48430641 |
ctttatcaatgcttttgattcaattttctctgtgcatatttgaattcttcaacatcaacaggtggccaggggaaaggcaattttggctagtgcaagggaa |
48430542 |
T |
|
| Q |
219 |
cttgaggatgaattatttggagagatgcaaacagttggaggctgagttacataaagggtgtcagaatagtcaactgatggggtcgtttgccaatgcattt |
318 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48430541 |
cttgaggctgaattatttggagagatgcaaacagttggaggctgagttacatgaagggtgtcagaatagtcaactgatggggtcgtttaccaatgcattt |
48430442 |
T |
|
| Q |
319 |
tacacagg |
326 |
Q |
| |
|
|||||||| |
|
|
| T |
48430441 |
tacacagg |
48430434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 80 - 114
Target Start/End: Original strand, 34114494 - 34114528
Alignment:
| Q |
80 |
aggcaagtttttctggaaatcttaacaaagtttat |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
34114494 |
aggcaagtttttctggaaatgttaacaaagtttat |
34114528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 80 - 113
Target Start/End: Original strand, 34148677 - 34148710
Alignment:
| Q |
80 |
aggcaagtttttctggaaatcttaacaaagttta |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
34148677 |
aggcaagtttttctggaaatgttaacaaagttta |
34148710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 80 - 113
Target Start/End: Original strand, 34161293 - 34161326
Alignment:
| Q |
80 |
aggcaagtttttctggaaatcttaacaaagttta |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
34161293 |
aggcaagtttttctggaaatgttaacaaagttta |
34161326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 81 - 141
Target Start/End: Complemental strand, 52805684 - 52805622
Alignment:
| Q |
81 |
ggcaagttt-ttctggaaatcttaacaaagtttatggagc-tttatcaatgcttttgattcaa |
141 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |||| ||| |||| ||||||||||||||||| |
|
|
| T |
52805684 |
ggcaagtttcttctgcaaatcttaacaaagtctatgtagcctttagcaatgcttttgattcaa |
52805622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University