View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4606_low_6 (Length: 239)
Name: NF4606_low_6
Description: NF4606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4606_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 33822776 - 33822557
Alignment:
| Q |
2 |
attataaactatcgagctcattaaacacaagtactaattgattcacattgagaatacatttatagctatttttgggcaaaacgattttgaaagatcgatc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
33822776 |
attataaactatcgagctcattaaacacaagtactaattggttcacattgagaatacatttatagctattttagggcaaaacgattttgaaagatcaatc |
33822677 |
T |
 |
| Q |
102 |
aaaatatgaccggcaaaaggacaaagaaatcaaactgtttggatgtataaaaataacaaagtggctttatagacactaattactctcaagtagggcatgc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33822676 |
aaaatatgaccggcaaaaggacaaagaaatcaaactgtttggatgtataaaaataacaaagtggctttatagacactaattactctcaagtagggcatgc |
33822577 |
T |
 |
| Q |
202 |
aaaatgatttttccacctta |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33822576 |
aaaatgatttttccacctta |
33822557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University