View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4606_low_7 (Length: 205)
Name: NF4606_low_7
Description: NF4606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4606_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 34326959 - 34327145
Alignment:
| Q |
1 |
gtaagcagttgatta-gatataaacttttgcagctaaaaatgtgagagtttctctcctttcaaatgcaagacaatcaaaccattaaatttctaaataatt |
99 |
Q |
| |
|
||||||||||||| | ||| |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
34326959 |
gtaagcagttgatcaagatctaaacttttgttgctgaaaatgtaagagtttctctcctttcaaatgcaagacaatcaaaccactaaatttctaaata-tt |
34327057 |
T |
|
| Q |
100 |
ataccgacaaaatgtttcatgtgtgcttttcaatcaaaaatagtttgagtgtctttgtcagttaaaagtactttcttacaagcatgat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34327058 |
ataccgacaaaatgtttcatgtgtgcttttcaatcaaaaatagtttgagtgtctttgtgagtaaaaagtactttcttacaagcatgat |
34327145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University