View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607-Insertion-15 (Length: 375)
Name: NF4607-Insertion-15
Description: NF4607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607-Insertion-15 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 159 - 375
Target Start/End: Complemental strand, 29142697 - 29142483
Alignment:
| Q |
159 |
tctaaacaagtttttagcatggacatatggtaattgtagttcagttaaaaatatattctttattagtagattttttattctagttacgctttatattttc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
29142697 |
tctaaacaagtttttagcatggacatatgttaattgtagttcagttaaaagtatattctttattagtagattttttattctagttatacttcatattttc |
29142598 |
T |
 |
| Q |
259 |
ttgataaaaaccctcaaaatcaaaatatttaacggtgaaacacaaaata-tctttaaggaacattcttgtaaacttacataaactaagtttgtgtgaaca |
357 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||||| |||| | |||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
29142597 |
ttgataacaaccctcaaaattaaaatatttaacggtgaaatccaaaatattcttggcgtaacattctcgtaaacttacataaattaagtttgtgtgaac- |
29142499 |
T |
 |
| Q |
358 |
atatacttgaacttagtt |
375 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29142498 |
--atacttgaacttagtt |
29142483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 10 - 97
Target Start/End: Complemental strand, 29142846 - 29142759
Alignment:
| Q |
10 |
tgtgatcatcaataattggcaggttcaacactatcatcataataataatgkgaagtcattgttatcctatctatcaccccatatactt |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29142846 |
tgtgatcaccaataattggcaggttcaacactatcatcataataataatgtgaagtcattgttatcctatctatcaccccatatactt |
29142759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University