View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607-Insertion-17 (Length: 432)
Name: NF4607-Insertion-17
Description: NF4607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607-Insertion-17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 134 - 432
Target Start/End: Original strand, 16947767 - 16948065
Alignment:
| Q |
134 |
gaattaaattcacctgagagtgtaaagcaatggctttgcctctaagctgattgaaacgtttctttccaacaatatcacgtgtaaccacaacaagtggagc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16947767 |
gaattaaattcacctgagagtgtaaagcaatggctttgcctctaagctgattgaaacgtttctttccaacaatatcacgagtaaccacaacaagtggagc |
16947866 |
T |
 |
| Q |
234 |
aaaaatacctttcccttcattaacattcttcatcataggttgcaacctcactggcttactaactcttccaatacgaagttgcgaagaaactgacttagtc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16947867 |
aaaaatacctttcccttcattaacattcttcatcataggttgcaacctcactggtttactaactcttccaatacgaagttgcgaagaaactgacttagcc |
16947966 |
T |
 |
| Q |
334 |
aacatggtgtaatcttcaccaactatagaagttccccagcttccatagaatgatgaaccaacacaacctgttgcagaaattgaagtggccattttagtt |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16947967 |
aacatggtgtaatcttcaccaactatagaagttccccagcttccatagaatgatgaaccaacacaacctgttgcagaaattgaagtggccattttagtt |
16948065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University