View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607-Insertion-2 (Length: 93)
Name: NF4607-Insertion-2
Description: NF4607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607-Insertion-2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 36059531 - 36059617
Alignment:
| Q |
7 |
acccccaacaaaggattccagaccaaaccactagcaggggtgatggtttctggaaaggatgttgtgctgctctatgttgctgttgtg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36059531 |
acccccaacaaaggattccagaccaaaccactagcaggggtgatggtttctggaaaggatgttgtgctgctctatgttgctgttgtg |
36059617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 1e-25; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 7 - 93
Target Start/End: Complemental strand, 28862740 - 28862654
Alignment:
| Q |
7 |
acccccaacaaaggattccagaccaaaccactagcaggggtgatggtttctggaaaggatgttgtgctgctctatgttgctgttgtg |
93 |
Q |
| |
|
|||| ||||||| |||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||| |
|
|
| T |
28862740 |
accctcaacaaaagatttcagaccaaactactagcaggggtgatggtttctggaagggatgttgtgctgctatatgttgctgctgtg |
28862654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 28865503 - 28865589
Alignment:
| Q |
7 |
acccccaacaaaggattccagaccaaaccactagcaggggtgatggtttctggaaaggatgttgtgctgctctatgttgctgttgtg |
93 |
Q |
| |
|
|||| ||||||| |||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||| |
|
|
| T |
28865503 |
accctcaacaaaagatttcagaccaaactactagcaggggtgatggtttctggaagggatgttgtgctgctatatgttgctgctgtg |
28865589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 67
Target Start/End: Original strand, 28859353 - 28859389
Alignment:
| Q |
31 |
aaaccactagcaggggtgatggtttctggaaaggatg |
67 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28859353 |
aaacaactagcaggggtgatggtttctggaaaggatg |
28859389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 15 - 85
Target Start/End: Original strand, 15099548 - 15099618
Alignment:
| Q |
15 |
caaaggattccagaccaaaccactagcaggggtgatggtttctggaaaggatgttgtgctgctctatgttg |
85 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15099548 |
caaaggattccagaccaaaccactaccagaggtgatggtttctggaagggatgttgtgctgctctatgttg |
15099618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 15 - 85
Target Start/End: Original strand, 15110783 - 15110853
Alignment:
| Q |
15 |
caaaggattccagaccaaaccactagcaggggtgatggtttctggaaaggatgttgtgctgctctatgttg |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15110783 |
caaaggattccagaccaaagcactaccagaggtgatggtttctggaagggatgttgtgctgctctatgttg |
15110853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 15 - 85
Target Start/End: Complemental strand, 18616901 - 18616831
Alignment:
| Q |
15 |
caaaggattccagaccaaaccactagcaggggtgatggtttctggaaaggatgttgtgctgctctatgttg |
85 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18616901 |
caaaggattccagaccaaagcactaccagaggtgatggtttctggaagggatgttgtgctgctctatgttg |
18616831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University