View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_1D_high_11 (Length: 227)
Name: NF4607_1D_high_11
Description: NF4607_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_1D_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 38014934 - 38015130
Alignment:
| Q |
17 |
aaggttcatgaaaggtcagataatagtcgttaacaaattcttataacatatatggtaagatgcacaattgcataaacaccttgcagtataaacaaatatc |
116 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| ||||||||||||||| ||||| | |||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38014934 |
aaggttcatgaaaggtcagacaatagccgttaataaattcttataacatttatggga-gatgcagaattgcataaacaccttacagtataaacaaatatc |
38015032 |
T |
 |
| Q |
117 |
cacttagaccaaagtgtcatttctctctctcaaattaaagccaaggcttattggtgggtgatatgattgatagaaatagagaggtgggggccaagggagt |
216 |
Q |
| |
|
||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38015033 |
cacgtggaccaaagtgtcatttttctctctcaaattaaagccaaggcttattggtgggtgatatgattgatagaa------aggtgggggccaagggagt |
38015126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University