View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_1D_high_8 (Length: 307)
Name: NF4607_1D_high_8
Description: NF4607_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_1D_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 221 - 307
Target Start/End: Complemental strand, 40662655 - 40662569
Alignment:
| Q |
221 |
attagacactttaagatttttgttacattgctgtctcggtaaatcaaaaatttgcgatgttgtcattctcaaataagtctgtgatgg |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
40662655 |
attagacactttaaggtttttgttacattgctgtctcggtaaatcaaaaacctgtgatgttgtcattctcaaataagtctgtgatgg |
40662569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University