View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4607_1D_low_16 (Length: 307)

Name: NF4607_1D_low_16
Description: NF4607_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4607_1D_low_16
NF4607_1D_low_16
[»] chr7 (1 HSPs)
chr7 (221-307)||(40662569-40662655)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 221 - 307
Target Start/End: Complemental strand, 40662655 - 40662569
Alignment:
221 attagacactttaagatttttgttacattgctgtctcggtaaatcaaaaatttgcgatgttgtcattctcaaataagtctgtgatgg 307  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||  || ||||||||||||||||||||||||||||||||    
40662655 attagacactttaaggtttttgttacattgctgtctcggtaaatcaaaaacctgtgatgttgtcattctcaaataagtctgtgatgg 40662569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University