View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_1D_low_27 (Length: 240)
Name: NF4607_1D_low_27
Description: NF4607_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_1D_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 41 - 232
Target Start/End: Complemental strand, 54952814 - 54952623
Alignment:
| Q |
41 |
gttgtgttgttgactgtgggataaacacacccgtccctttgccttgtcttctcaaagccatttgctcgtacaggaaatttgactgtggaggaggatggat |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54952814 |
gttgtgttgttgactgtgggataaacacacctgtccctttgctttgtcttctcaaagccatttgctcgtacaggaaatttgactgtggaggaggatggat |
54952715 |
T |
|
| Q |
141 |
tgctccagagaaagactgaaaatttgtttaagaatattaattaagatcataattatagttagcataatgaataaaatcactatttggtcaat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
54952714 |
tgctccagagaaagactgaaaatttgtttaagaatattaattaagatcataattatcgttagcataatgaataaaatcactctttggtcaat |
54952623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 22696615 - 22696662
Alignment:
| Q |
1 |
gaagaaacaaagaacagagaaagagataagatatccccatgttgtgtt |
48 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22696615 |
gaagaaaaaaagaacagagaaagagagaagatatccccatgttgtgtt |
22696662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University