View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_1D_low_6 (Length: 467)
Name: NF4607_1D_low_6
Description: NF4607_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_1D_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 390; Significance: 0; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 1 - 414
Target Start/End: Complemental strand, 23333008 - 23332595
Alignment:
| Q |
1 |
attgcactgttttggtatgttgattggaactaaccgtgtcatgtgtttgatgtgttggtcagccgaagacaaggttgccatcgtgtttcgccaaggaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333008 |
attgcactgttttggtatgttgattggaactaaccgtgtcatgtgtttgatgtgttggtcagccgaagacaaggttgccatcgtgtttcgccaaggaata |
23332909 |
T |
|
| Q |
101 |
tggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggat |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23332908 |
tggtttgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggat |
23332809 |
T |
|
| Q |
201 |
ggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagaga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332808 |
ggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagaga |
23332709 |
T |
|
| Q |
301 |
gatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332708 |
gatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctc |
23332609 |
T |
|
| Q |
401 |
attcgtccacatat |
414 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
23332608 |
attcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 93 - 187
Target Start/End: Original strand, 10955074 - 10955166
Alignment:
| Q |
93 |
aaggaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
187 |
Q |
| |
|
|||||||||||| |||| |||||||| |||||||| |||||||||| |||| |||||||||||||| ||||||||| ||| || |||||||| |
|
|
| T |
10955074 |
aaggaatatggtttgcacgttgatgactatgtcat--tgcgtgatcctaacaagaacatgttcgaggttaaggtccacaagaagaagggcaaggt |
10955166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 409 - 451
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
409 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
451 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 409 - 451
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
409 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
451 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 187
Target Start/End: Complemental strand, 2027759 - 2027692
Alignment:
| Q |
120 |
tatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
187 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||| |
|
|
| T |
2027759 |
tatgtcattttgcgtgatccaaacaagaacatgtttgaggttaaagttcacaagaaaaatggcaaggt |
2027692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University