View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_2D_high_2 (Length: 201)
Name: NF4607_2D_high_2
Description: NF4607_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_2D_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 78 - 183
Target Start/End: Complemental strand, 43985709 - 43985604
Alignment:
| Q |
78 |
ctgctttactgaagctttcaaagtatgcaaccgggcctgaaaatataatagaccataacggtttaaatcccgttgtgtatgtactgaaaaatggacttag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43985709 |
ctgctttactgaagctttcaaagtatgcaaccgggcctgaaaatataatagaccataacggtttaaagcccgttgtgtatgtactgaaaaatggacttag |
43985610 |
T |
|
| Q |
178 |
tcttga |
183 |
Q |
| |
|
|||||| |
|
|
| T |
43985609 |
tcttga |
43985604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 43985762 - 43985846
Alignment:
| Q |
1 |
tggtggcacagttccaacttcaatcaaacaagctctgttgaaaatgcttgaccttgttaacaaacgaatctcgtaagctgcttta |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985762 |
tggtggcacagttccaacttcaatcaaacaagctctgttgaaaatgcttgaccttgttaacaaacgaatctcgtaagctgcttta |
43985846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University