View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_2D_low_1 (Length: 325)
Name: NF4607_2D_low_1
Description: NF4607_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_2D_low_1 |
 |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0376 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 1802 - 1515
Alignment:
| Q |
20 |
cattattcatagaatagaatagaatagaagaaggagtaacaagttacaaaccttgtttttggcatttttatctatttagtaaaatgtgattttcccgtgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1802 |
cattattcatagaatagaatagaatagaagaaggagtaacaagttacaaaccttgtttttggcatttttatctatttagtaaaatgtgattttcccgtgt |
1703 |
T |
 |
| Q |
120 |
taaacattcctaaagcagtacggtaattaatataccattgtccccaatacagcagaagttcagcaactaccaccaatgtttcgagaaatcctcgatcaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1702 |
taaacattcctaaagcagtacggtaattaatataccattgtccccaatacagcagaagttcagcaactaccaccaatgtttctagaaatcctcgatcaat |
1603 |
T |
 |
| Q |
220 |
gtttaccattctaattcctcaaacacgatttttgaactgtggaaggaaataagggggattagggtttccttcccaacttcactaattt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1602 |
gtttaccattctaattcctcaaacacgatttttgaactgtggaaggaaataagggggattagggtttccttcccaacttcactaattt |
1515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 65 - 123
Target Start/End: Original strand, 38514485 - 38514544
Alignment:
| Q |
65 |
acaaaccttgtttttggcatttttatcta-tttagtaaaatgtgattttcccgtgttaaa |
123 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |||||||||||||| |||||| ||||||| |
|
|
| T |
38514485 |
acaaaccttgtttttggcatctttgtctactttagtaaaatgtggttttccgatgttaaa |
38514544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University