View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_2D_low_5 (Length: 233)
Name: NF4607_2D_low_5
Description: NF4607_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_2D_low_5 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 129 - 233
Target Start/End: Complemental strand, 1715243 - 1715139
Alignment:
| Q |
129 |
tcgctcgtatctctccgacagccgccgtagccgctgccgtgattcattctctcatttcatcttatctgcgatatttcggaacaggtgagtagcaaatttc |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1715243 |
tcgcttgtatctctccgacagccgccgtagccgctgccgtgattcattctctcatttcatcttatctgcgatattttggaacaggtgagtagcaaatttc |
1715144 |
T |
|
| Q |
229 |
ccagc |
233 |
Q |
| |
|
||||| |
|
|
| T |
1715143 |
ccagc |
1715139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 16 - 130
Target Start/End: Complemental strand, 1715393 - 1715272
Alignment:
| Q |
16 |
catcatgtgcaaagtaactaacaaggttt-------catcatttaaatgaccaacaagaatacgaccttccaactttagctccattggatggttgtgtgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715393 |
catcatgtgcaaagtaactaacaaggtttttctcttcatcatttaaatgaccaacaagaatacgaccttccaactttagctccattggatggttgtgtgc |
1715294 |
T |
|
| Q |
109 |
ctcatacacaacaccgagactc |
130 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1715293 |
ctcatacacaacaccgagactc |
1715272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 128 - 227
Target Start/End: Complemental strand, 30018324 - 30018228
Alignment:
| Q |
128 |
ctcgctcgtatctctccgacagccgccgtagccgctgccgtgattcattctctcatttcatcttatctgcgatatttcggaacaggtgagtagcaaattt |
227 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||||| |||| |||| ||||| ||||||||||| |||||| |||||| ||||||||||||| |||||| |
|
|
| T |
30018324 |
ctcgctcgtatctctccgatcgccaccgtcgccgc---cgtgcttcactctcttatttcatcttagctgcgacatttcgtaacaggtgagtagaaaattt |
30018228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University