View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_high_7 (Length: 235)
Name: NF4607_high_7
Description: NF4607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 31059812 - 31059606
Alignment:
| Q |
15 |
tattattcttgcagattccatttgaaatgtcacctaatgacatcaccaatcatagaaatcactcttccttttaagtggtctatttaacaaaccaattgca |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31059812 |
tattattcttgcagattccatttaaaatgtcacctaatgacatcaccaatcatagaaatcactcttccttttaagtggtctatttaacaaaccaattcca |
31059713 |
T |
 |
| Q |
115 |
ttgatgaccctttaacttgcctcttcaatttgtaaaattggagcaagtcatggagaagagaaaaggagataaaagtgaagaaagtaatgaagaaaaatgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31059712 |
ttgatgaccctttaacttgcctcttcaatttgtaaaattggagcaagtcatggagaagagaaaaggagataaaagtgaagaaagtaatgaagaaaaatgg |
31059613 |
T |
 |
| Q |
215 |
gtgtatg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
31059612 |
gtgtatg |
31059606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University