View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4607_low_3 (Length: 456)
Name: NF4607_low_3
Description: NF4607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4607_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 259 - 440
Target Start/End: Original strand, 27302626 - 27302807
Alignment:
| Q |
259 |
aattgattggtatagtcaatagtgttatggtcggagaaattcacatttattcgtagatgatgttgtgctcaacatgggtgtggcatttttccctatataa |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27302626 |
aattgattggtatagtcaatagtgttatggtcggagacattcacatttattcgtagatgatgttgtgctcaacatgggtgtggcatttttccctatataa |
27302725 |
T |
 |
| Q |
359 |
aatacagcttctagacatgtattgctacactgttatgtgtcatttctaatgttgatcaattacaaatatttcatcactatta |
440 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27302726 |
aatacagcttctaaacatgtattgctacactgttatgtgtcatttctaatgttgatcaattacaaatatttcatcactatta |
27302807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 117 - 210
Target Start/End: Original strand, 27302252 - 27302345
Alignment:
| Q |
117 |
caacttttacctcgacttctttaaaacacccctcatttatataaggatgcttctctgctgacatggtcatggggatggtgaccgatttatagag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27302252 |
caacttttacctcgacttctttaaaacacccctcatttatataacgatgcttctctgctgacatggtcatggggatggtgaccgatttatagag |
27302345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University