View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4609-Insertion-5 (Length: 230)
Name: NF4609-Insertion-5
Description: NF4609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4609-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 6 - 191
Target Start/End: Original strand, 41255242 - 41255427
Alignment:
| Q |
6 |
cacgttcaaccatcaacaactggtttcaattatgcatcaaatgatttcaaagttagatgattgtaatgcagctaatatgcaaatattttcaataagggtt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41255242 |
cacgttcaaccatcaacaactggtttcaattatgcatcaaatgatttcaaagttagatgattgtaatgcagctaatatgcaaatattttcaataagggtt |
41255341 |
T |
|
| Q |
106 |
ataacattctttttaacctatatagacttggtagcctcgttcaaccgtcaatcaattcagttgtcagtcgattcacaccatcaact |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41255342 |
ataacattctttttaacctatatagacttggtagtctcgttcaaccgtcaatcaattcagatgtcagtcgattcacaccatcaact |
41255427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 194 - 230
Target Start/End: Original strand, 41255446 - 41255482
Alignment:
| Q |
194 |
ttgtgacgaagctgatatgcagataactctttttcag |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41255446 |
ttgtgacgaagctgatatgcagataactctttttcag |
41255482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University