View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4609-Insertion-6 (Length: 140)
Name: NF4609-Insertion-6
Description: NF4609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4609-Insertion-6 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 3e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 44 - 140
Target Start/End: Original strand, 46740744 - 46740840
Alignment:
| Q |
44 |
tcctacccattgcatacctatagtttagtaactctatttggttacattctagtctagtctagtagcatgcactagtaaacaaaaccgtcattctcca |
140 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46740744 |
tcctacccattgcataactatagtttagtaactctatttggttacattctagtctagtctagtagcatgcactagtaaacaaaactgtcattctcca |
46740840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 46740627 - 46740664
Alignment:
| Q |
8 |
tcaaatatgtcggagatgtgaatgaaattcaatttctc |
45 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46740627 |
tcaaatatgttggagatgtgaatgaaattcaatttctc |
46740664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University