View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4609_low_6 (Length: 209)
Name: NF4609_low_6
Description: NF4609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4609_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 42932395 - 42932218
Alignment:
| Q |
15 |
atcacatttgcagaaacagttccaaacctgattaaggatgaagcaaccaactttagttattgtgaaaatgataacaggataagcatcacgacgcaattag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932395 |
atcacatttgcagaaacagttccaaacctgattaaggatgaagcaaccgactttagttattgttaaaatgataacaggataagcatcacgacgcaattag |
42932296 |
T |
|
| Q |
115 |
aaacatgatgatttaaaacttacgaacaatctgcaggataaccattgatttctctgcaaccccctttagggcatagat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42932295 |
aaacatgatgatttaaaacttacgaacaatctgcaggataaccattgatttctctgcaaccccctttagggcaaagat |
42932218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University