View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4610-Insertion-10 (Length: 220)
Name: NF4610-Insertion-10
Description: NF4610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4610-Insertion-10 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 38310319 - 38310416
Alignment:
| Q |
123 |
ctaatgttcaatgttggatgaaactagtatgtaaatctacttgaatgggaacatatttcaggtattgttcttgcaccttatttcacttggtttctctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38310319 |
ctaatgttcaatgttggatgaaactagtatgtaaatctacttgaatgggaacatatttcaggtattgttcttgcaccttatttcacttggtttctctc |
38310416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 38310203 - 38310256
Alignment:
| Q |
7 |
aaaactatatatggttgttaggctatgttttttggacttactggcggacttaga |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38310203 |
aaaactatatatggttgttaggctatgttttttggacttactggcggacttaga |
38310256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 210
Target Start/End: Original strand, 38301721 - 38301761
Alignment:
| Q |
170 |
ggaacatatttcaggtattgttcttgcaccttatttcactt |
210 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
38301721 |
ggaacaaatttcgggtattgttcttgcaccttatttcactt |
38301761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University