View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4610-Insertion-9 (Length: 261)
Name: NF4610-Insertion-9
Description: NF4610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4610-Insertion-9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 50391348 - 50391595
Alignment:
| Q |
8 |
gctattgcttctctcgacttttaacatcctctcctcaggattagaaattgagatatggatcctgatctgattggtttgatagcgagtgacttaatagttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
50391348 |
gctattgcttctctcgacttttaacaccctctcctcaggattagaaactgagatatggattgtgatctgattgatttgatagcgattgactcaatagttt |
50391447 |
T |
 |
| Q |
108 |
tttagattataatgtaatcttaaaattgaagttgaatctaactcattgattac-------acttataagatgaaagttgtgactcacttgttacaaacca |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50391448 |
tttagattataatataatcttaaaattgaagttgaatctaactcattgattacaaaactgacttataagatgaaagttgcgactcacttgttacaaacca |
50391547 |
T |
 |
| Q |
201 |
tcgtttccttcaatgtctgttttcctacttgtagatggattaaaagcc |
248 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50391548 |
tcatttccttcaatgtctgttttcctacttgtagatggattaaaagcc |
50391595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University