View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4610_high_10 (Length: 260)
Name: NF4610_high_10
Description: NF4610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4610_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 28879247 - 28879464
Alignment:
| Q |
1 |
attatatttatttatattttgattggacaacattattcacccctctccttagttcatgcattcgtagtttcaacatctatggcagaagcaaaactaaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28879247 |
attatatttatttatattttgattggacaacattattcacccctctccttagttcatgcattcatagtttcaacatctatggcagaagcaaaactaaggt |
28879346 |
T |
 |
| Q |
101 |
tagtatgactactacactactttgaattgaactacttcacttttctggggcccatatgattttcttcttcnnnnnnngacaaaattctttcatatcaacc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28879347 |
tagtatgactactacactact-----ttgaactacttcacttttctggggcccatatgattttcttcttctttttttgacaaaattctttcatatcaacc |
28879441 |
T |
 |
| Q |
201 |
agcctacatgcaaagattcaata |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28879442 |
agcctacatgcaaagattcaata |
28879464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 33 - 114
Target Start/End: Original strand, 28883814 - 28883897
Alignment:
| Q |
33 |
ttattcacccctctccttagttcatgcattcgtag--tttcaacatctatggcagaagcaaaactaaggttagtatgactacta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | ||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28883814 |
ttattcacccctctccttagttcatgcattcattgaatttcagcatctatggcagaagcaaaactaaggttagtattactacta |
28883897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University