View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4610_high_7 (Length: 326)
Name: NF4610_high_7
Description: NF4610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4610_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 17 - 312
Target Start/End: Original strand, 6800465 - 6800760
Alignment:
| Q |
17 |
aaaacaaccccgttgtttcgaattcctcgaccactcaaaccctagcttcttactcgtggtctgatatgtcgccttcaaggaatcatcgccataaactttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6800465 |
aaaacaaccccgttgtttcgaattcctcgaccactcaaaccctagcttcttactcgtggtctgatacgtcgccttcaaggaatcatcgccataaactttc |
6800564 |
T |
 |
| Q |
117 |
ctcgaaacagcaaaatcccacgcattcttggcaacatcataactaggttcaattgtagtcaaacccttatgaacatagctatacttcaacctacaattcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6800565 |
ctcgaaacagcaaaatcccacgcattcttggcaacatcataactaggttcaattgtagtcaaacccttatgaacatagctatacttcaacctacaattcc |
6800664 |
T |
 |
| Q |
217 |
cagattcaacaccataattggctgaaaccttgtttgacgggtcccacacaaatgttccgtccaaaattgttctgttatcccctttgctgtgtatgt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6800665 |
cagattcaacaccataattggctgaaaccttgtttgacgggtcccacacaaatgttccgtccaaaattgttctgttatcccctttgctgtgtatgt |
6800760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University