View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4610_high_9 (Length: 281)
Name: NF4610_high_9
Description: NF4610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4610_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 8e-33; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 197 - 268
Target Start/End: Complemental strand, 31719254 - 31719183
Alignment:
| Q |
197 |
atggtagtaggtaataagtttaaacattctgtctccaagaaatgagaaactttgtattgttgtatttatctc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31719254 |
atggtagtaggtaataagtttaaacattctgtctccaagaaatgagaaactttgtattgttgtatttatctc |
31719183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 81 - 194
Target Start/End: Complemental strand, 31719430 - 31719316
Alignment:
| Q |
81 |
tcaggcgtaaggtggtcttctaaggttattacaaccggatacacatcttatttcttaactgtctgcttga-nnnnnnnnnnngttgaaagaaactctctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
31719430 |
tcaggcgtaaggtggtcttctaaggttattacaaccggatacacatcttatttcttaactctctgcttgattttttttttttgttgaaagaaactctctg |
31719331 |
T |
|
| Q |
180 |
cttgattgttgattg |
194 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31719330 |
cttgattgttgattg |
31719316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 61 - 121
Target Start/End: Original strand, 31012327 - 31012387
Alignment:
| Q |
61 |
gagccactatggcttgaagatcaggcgtaaggtggtcttctaaggttattacaaccggata |
121 |
Q |
| |
|
|||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31012327 |
gagccactttggcctgaagatcaggagtaaggtggtcttctaaggttattacaaccggata |
31012387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 61 - 121
Target Start/End: Complemental strand, 31709001 - 31708941
Alignment:
| Q |
61 |
gagccactatggcttgaagatcaggcgtaaggtggtcttctaaggttattacaaccggata |
121 |
Q |
| |
|
|||||||| |||| ||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31709001 |
gagccactttggcctgaagatcaggagtaagatggtcttctaaggttattacaaccggata |
31708941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 31719555 - 31719514
Alignment:
| Q |
1 |
tataagaatgtaatcattttgaatcctattagaattagaatt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31719555 |
tataagaatgtaatcattttgaatcctattagaattagaatt |
31719514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 63 - 119
Target Start/End: Complemental strand, 35550792 - 35550736
Alignment:
| Q |
63 |
gccactatggcttgaagatcaggcgtaaggtggtcttctaaggttattacaaccgga |
119 |
Q |
| |
|
|||||| ||||||||||||| || ||||| |||||||||| |||||||||||||||| |
|
|
| T |
35550792 |
gccactttggcttgaagatctggagtaagatggtcttctagggttattacaaccgga |
35550736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University