View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4610_low_9 (Length: 319)
Name: NF4610_low_9
Description: NF4610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4610_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 171 - 306
Target Start/End: Original strand, 15582457 - 15582590
Alignment:
| Q |
171 |
catttggggaatgaaaaataccaaccaatatgactcagttgatgaatagaacacagccataaggagcaaaaacagttgtgacaatgtgcgttctgtttct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15582457 |
catttggggaatgaaaaataccaaccaatgtgactcagttgatgaa-----cacagccgtaaggagcaaaaacagctgtgacaatgtgcgttctgtttct |
15582551 |
T |
|
| Q |
271 |
tctggtttatgtc---tttttatatatgtatggggaagg |
306 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15582552 |
tctggtttatgtcttttttttatatatgtatggggaagg |
15582590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 9 - 101
Target Start/End: Original strand, 15582296 - 15582388
Alignment:
| Q |
9 |
acatcatcattatcattaccatgtcttctcctcttagatattattatttgttgagtcatattatctaaaatataatttattcagataaacacc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15582296 |
acatcatcattatcattaccatgtcttctcctcttagatattattatttgttgaatcatattatctaaaatataatttattcagataaacacc |
15582388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University