View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4611_high_12 (Length: 322)
Name: NF4611_high_12
Description: NF4611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4611_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 30 - 296
Target Start/End: Complemental strand, 869340 - 869074
Alignment:
| Q |
30 |
tctctctcatctggagcttcgaatggacaaccttggcgataatgagattatacatgaaagcccatcaaagttggattgcattggtgcagcagtcaatgtg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869340 |
tctctctcatctggagcttcgaatggacaaccttggcgataatgagattatacatgaaagcccatcaaagttggattgcattggtgcagcagtcaatgtg |
869241 |
T |
|
| Q |
130 |
gaaactctaaaattgtggggtgtcttgatcaaacttatccctaaatgggaaacgttccataatcttaggatccttgaagttgttggggcaagagtcgagg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869240 |
gaaactctaaaattgtggggtgtcttgatcaaacttatccctaaatgggaaacgttccataatcttaggatccttgaagttgttggggcaagagtcgagg |
869141 |
T |
|
| Q |
230 |
acgctgcagtaaatgcaatgattcaggcctgtccaaatctgacaaggttactactgcttggatgtga |
296 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869140 |
atgctgcagtaaatgcaatgattcaggcctgtccaaatctgacaaggttactactgcttggatgtga |
869074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University