View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4612-Insertion-2 (Length: 126)
Name: NF4612-Insertion-2
Description: NF4612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4612-Insertion-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 43; Significance: 7e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 10 - 77
Target Start/End: Original strand, 7720979 - 7721046
Alignment:
| Q |
10 |
aacaccagccaaaagaggcacattacaacaccnnnnnnnccacacctaaacctgttagtatcaaccgt |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
7720979 |
aacaccagccaaaagaggcacattacaacaccaaaaaaaccacacctaaacctgttaatatcaaccgt |
7721046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University