View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4612_high_17 (Length: 309)
Name: NF4612_high_17
Description: NF4612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4612_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 107 - 239
Target Start/End: Complemental strand, 39077473 - 39077338
Alignment:
| Q |
107 |
agcaattaaaatcagaaaactaatcatctttgaatatagtcccaatagaacacaaccagcaaaacaatcacctagccatgtccaaagtctaattctatta |
206 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39077473 |
agcaattaaaatcagaaaactaaccatctttaaatatagtcccaatagaacacaaccagcaaaacaatcaccaagccatgtccaaattctaattctatta |
39077374 |
T |
 |
| Q |
207 |
cagtcaa---atcaacatagtaatttcataaaatac |
239 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| |
|
|
| T |
39077373 |
cagtcaaatcatcaacaaagtaatttcataaaatac |
39077338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 39077610 - 39077508
Alignment:
| Q |
1 |
ttttaaacatgattaaaccatgcacatagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaattc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39077610 |
ttttaaacatgattaaacca----catagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaagtc |
39077515 |
T |
 |
| Q |
101 |
catatca |
107 |
Q |
| |
|
||||||| |
|
|
| T |
39077514 |
catatca |
39077508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 235 - 298
Target Start/End: Complemental strand, 39072574 - 39072511
Alignment:
| Q |
235 |
aatactacatcaaatgtcatttacaaagaggtattccgcaatttgtaatgagtcctgctctctg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39072574 |
aatactacatcaaatgtcatttacaaagaggtattccgcaatttgtaatgagtcctgctgtctg |
39072511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 2317405 - 2317303
Alignment:
| Q |
1 |
ttttaaacatgattaaaccatgcacatagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaattc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2317405 |
ttttaaacatgattaaacca----catagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaattc |
2317310 |
T |
 |
| Q |
101 |
catatca |
107 |
Q |
| |
|
||||||| |
|
|
| T |
2317309 |
catatca |
2317303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University