View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4612_high_9 (Length: 350)
Name: NF4612_high_9
Description: NF4612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4612_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 3 - 341
Target Start/End: Complemental strand, 49083781 - 49083443
Alignment:
| Q |
3 |
gctgccaggagaatctctttgtaaagaaagttcaaattgtgtatcaaaatcaaacttggcggtattaccaccactgaaactacaatttgcatgattgttc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083781 |
gctgccaggagaatctctttgtaaagaaagttcaaattgtgtatcaaaatcaaacttggcggtattaccaccactgaaactacaatttgcatgattgttc |
49083682 |
T |
|
| Q |
103 |
tttggatatttatcaaaagtggccatcaagtcaatagctccagcagaatggtcttctagttcattattgctttgatgaatctttgtattaatatgaggat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083681 |
tttggatatttatcaaaagtggccatcaagtcaatagctccagcagaatggtcttctagttcattattgctttgatgaatctttgtattaatatgaggat |
49083582 |
T |
|
| Q |
203 |
gggctttgcttaactctgttcctaacacttcatcacggttttctgtttcactgtaatcatagttttgaccaagccttaaacctgttgaaattttgtcaca |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083581 |
gggctttgcttaactctgttcctaacacttcatcacggttttctgtttcactataatcatagttttgaccaagccttaaacctgttgaaattttgtcaca |
49083482 |
T |
|
| Q |
303 |
ccctgcagctttagatgctattgtagttgatttctctgc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083481 |
ccctgcagctttagatgctattgtagttgatttctctgc |
49083443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University