View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4613-Insertion-10 (Length: 139)
Name: NF4613-Insertion-10
Description: NF4613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4613-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 6 - 139
Target Start/End: Original strand, 2045254 - 2045387
Alignment:
| Q |
6 |
catgcaattcgtcaacaatgtcatcattcacggtcttcgcatcaagaacattaaagctaagaatggtggtttgattagagactctttcgatcatctcgga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2045254 |
catgcaattcgtcaacaatgtcatcattcacggtcttcgcatcaagaacattaaagctaagaatggtggtttgattagagactctttcgatcatctcgga |
2045353 |
T |
|
| Q |
106 |
gtaagaacaaggagtgatggtgatgctatctctg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2045354 |
gtaagaacaaggagtgatggtgatgctatctctg |
2045387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 70 - 138
Target Start/End: Complemental strand, 3225150 - 3225082
Alignment:
| Q |
70 |
ggtggtttgattagagactctttcgatcatctcggagtaagaacaaggagtgatggtgatgctatctct |
138 |
Q |
| |
|
|||||||||||||| || ||||| || ||| ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
3225150 |
ggtggtttgattagggattcttttgaccatactggacaaagaacaagaagtgatggtgatgctatctct |
3225082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University