View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4613-Insertion-13 (Length: 90)
Name: NF4613-Insertion-13
Description: NF4613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4613-Insertion-13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 4e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 50073859 - 50073941
Alignment:
| Q |
8 |
ttggtgtggattgatatgttggcatatgcgttaatttataggcgctgcaatgcagcaataggtcactgtggagttacccctag |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
50073859 |
ttggtgtggattgatatgttggcatatgcgttaatttataggcgctgcaatggagcaataggtcactgtggagttgcccctag |
50073941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University