View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4614-Insertion-12 (Length: 290)
Name: NF4614-Insertion-12
Description: NF4614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4614-Insertion-12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 8 - 116
Target Start/End: Original strand, 46249171 - 46249279
Alignment:
| Q |
8 |
gaaacaatgactcaattcccttttccttcaacttttctctcaacggctccgatatcttaaatttagaaatcccattgggatcctccaccttgttttccat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46249171 |
gaaacaatgactcaattcccttttccttcaacttttctctcaacggctccgatatcttaaatttagaaatcccattgggatcctccaccttgttttccat |
46249270 |
T |
 |
| Q |
108 |
tactacaaa |
116 |
Q |
| |
|
||||||||| |
|
|
| T |
46249271 |
tactacaaa |
46249279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 162 - 233
Target Start/End: Original strand, 46249325 - 46249396
Alignment:
| Q |
162 |
atccaactctaaactattctcattatcgtctctattggtcgtcgtcattgtctataacacggaagccttacg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46249325 |
atccaactctaaactattctcattatcgtctccattggtcgtcgtcattgtctataacatggaagccttacg |
46249396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 290
Target Start/End: Original strand, 46249425 - 46249453
Alignment:
| Q |
262 |
gaaaccacatctggatgttttcttgttgt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46249425 |
gaaaccacatctggatgttttcttgttgt |
46249453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University