View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4614-Insertion-15 (Length: 239)
Name: NF4614-Insertion-15
Description: NF4614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4614-Insertion-15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 7 - 239
Target Start/End: Original strand, 13140089 - 13140326
Alignment:
| Q |
7 |
aggtttccacagaaagaccccttggttctggcaaacagatcacaattacagtcatggccaaaacattcattcccatgatttctttcgaaaattgccttga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
13140089 |
aggtttccacagaaagaccccttggttctggcaaacagatcacaattacaatcatggccaaaacactcattcccatgatttctttcgaaaaatgccttga |
13140188 |
T |
|
| Q |
107 |
gtcataagcacatatctttgctacaccatgcatgagctgcc-aaatttctaccaaatgnnnnnnnntcccgccttaaatcaaattattcgcttatctcct |
205 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
13140189 |
gtcataagcacatctatttgctacaccatgcatgagctgccaaaatttctaccaaatgaaaaaaaatccctccttaaatcaaattattcgcttatctcct |
13140288 |
T |
|
| Q |
206 |
tcccaaactttgagtaaa----ttcgtcaaaatgccca |
239 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| |
|
|
| T |
13140289 |
tcccgaactttgagtaaatgctttcgtcaaaatgccca |
13140326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University