View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4615-Insertion-11 (Length: 157)
Name: NF4615-Insertion-11
Description: NF4615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4615-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 51858016 - 51858166
Alignment:
| Q |
8 |
agatgatgacacggttgactggctaaatcttactcgagagttatggttagttactatatccnnnnnnntctt-cgattccgtagtgtctgtgctttatgg |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| ||||||||||||| ||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
51858016 |
agatgatgacacggttgattggctaaatcttcctcgagacttatggttagttattatatccaaaaaaaaatttcgattccgtagtgcctgtgctttatgg |
51858115 |
T |
|
| Q |
107 |
cgctctattctttcccctccttttcatagacttcatattcaagctgctaag |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51858116 |
cgctctattctttcccctccttttcatagacttcatattcaagctgctaag |
51858166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 9e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 9e-19
Query Start/End: Original strand, 76 - 131
Target Start/End: Complemental strand, 34865455 - 34865400
Alignment:
| Q |
76 |
tcttcgattccgtagtgtctgtgctttatggcgctctattctttcccctccttttc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
34865455 |
tcttcgattccgtagtgtctgtgctttattgcgctctattcttccccctccttttc |
34865400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 34865538 - 34865479
Alignment:
| Q |
9 |
gatgatgacacggttgactggctaaatcttactcgagagttatggttagttactatatcc |
68 |
Q |
| |
|
||||||||| | |||||||||||||||||| ||||||| ||||||||||||| ||||||| |
|
|
| T |
34865538 |
gatgatgacgcagttgactggctaaatcttcctcgagaattatggttagttattatatcc |
34865479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University