View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4616_high_3 (Length: 231)
Name: NF4616_high_3
Description: NF4616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4616_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 19795832 - 19795615
Alignment:
| Q |
1 |
tagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatggggtttgatt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19795832 |
tagggttcgtgatcggttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatggggtttgatt |
19795733 |
T |
|
| Q |
101 |
ccttacaatagggttgcttctgtggcgatgaagttttataaggagaagtttttgaagcatgataaggagaggtttgagaagtacttggaggatgtgaagg |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19795732 |
ccatacaatagggttgcttctgtggcgatgaagttttataaggagaagtttttgaagcatgataaggagaggtttgagaagtacttggaggatgtgaagg |
19795633 |
T |
|
| Q |
201 |
cagggaagactactattg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19795632 |
cagggaagactactattg |
19795615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 19785755 - 19785972
Alignment:
| Q |
1 |
tagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatggggtttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19785755 |
tagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatggggtttgatt |
19785854 |
T |
|
| Q |
101 |
ccttacaatagggttgcttctgtggcgatgaagttttataaggagaagtttttgaagcatgataaggagaggtttgagaagtacttggaggatgtgaagg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19785855 |
ccttacaatagagttgcttctgtggcgatgaagttttataaggaaaagtttttgaagcatgataaggagaggtttgagaagtacttgaaggatgtgaagg |
19785954 |
T |
|
| Q |
201 |
cagggaagactactattg |
218 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
19785955 |
caggaaagactactattg |
19785972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 15835139 - 15834924
Alignment:
| Q |
1 |
tagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatggggtttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15835139 |
tagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggcgttgcaattgcctgaggtgtttattggggctaatcaatggggtttgatt |
15835040 |
T |
|
| Q |
101 |
ccttacaatagggttgcttctgtggcgatgaagttttataaggagaagtttttgaagcatgataaggagaggtttgagaagtacttggaggatgtgaagg |
200 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15835039 |
ccttataatagggttgcttctgtggccatggagttttataaggagaagtttttgaagcatgatgaggagaggtttgagaagtacttgcaggatgtgaagg |
15834940 |
T |
|
| Q |
201 |
cagggaagactactat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15834939 |
cagggaagactactat |
15834924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 47712731 - 47712519
Alignment:
| Q |
1 |
tagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatggggtttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||| |||| |||||| |
|
|
| T |
47712731 |
tagggttcgtgatcgtttgaggaaggatgtgttggtgccattgaggaaggttttggagttgcctgaggtgtttattggggctaatcgatggaaattgatt |
47712632 |
T |
|
| Q |
101 |
ccttacaatagggttgcttctgtggcgatgaagttttataaggagaagtttttgaagcatgataaggagaggtttgagaagtacttggaggatgtgaagg |
200 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||| | |
|
|
| T |
47712631 |
ccttacaacagggttgcgtctgtggcgatggagttttataaagagaagtttttgaagcatgataaaaagaggtttgagaagtatttggaggatgtgaaag |
47712532 |
T |
|
| Q |
201 |
cagggaagactac |
213 |
Q |
| |
|
||||||||||| |
|
|
| T |
47712531 |
tggggaagactac |
47712519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University