View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4617_high_19 (Length: 240)
Name: NF4617_high_19
Description: NF4617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4617_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 8549952 - 8549725
Alignment:
| Q |
1 |
ttatacataaatttattgttcaactcgcttttagatgtatgcataaatataattcacttttcctttaatttactttttacgaaaataaattttac----- |
95 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8549952 |
ttatacacaaatttattgttcaactcgcttttacatgtatgcagaaatataattcacttttcctttaatttgctttttacgaaaataaattttacataac |
8549853 |
T |
|
| Q |
96 |
caattcatcaaaatcaaattttgttagatcaaaatcaaacgcacagtattggttagataatattggtttcttatactcgagagttttatatcaacatgac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8549852 |
caattcatcaaaatcaaattttgttagatcaaaatcaaacgcacaatattggttagataatattggtttcttatactcgagagttttatatcaacatgac |
8549753 |
T |
|
| Q |
196 |
tctgcaaaactgcaaccaaagctcaaac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8549752 |
tctgcaaaactgcaaccaaagctcaaac |
8549725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University