View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4617_high_25 (Length: 211)
Name: NF4617_high_25
Description: NF4617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4617_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 43815168 - 43815351
Alignment:
| Q |
19 |
caaattccattcgcgcattggtttgcagcaccaaaatcggagccgacgcaaacacaatcgattctcttcctaatcttgagattgtgtctacttacagcgt |
118 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||||||||| || ||||| |||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
43815168 |
caaattcaattcgtgcattggtttgcaacaccaaaatcggagcggatgcaaatacaatcgattctcttcctaatcttgagattgtttctacttacagtgt |
43815267 |
T |
 |
| Q |
119 |
tggatttgataaaattgatctgaagaattgcagagagaaaggaatttgggttacgaatacgccgaatgtattgactgatgatgt |
202 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
43815268 |
tggatttgataaaattgatctgaagaaatgcagggagaaagggatttgtgttacgaatacgccggatgtgttgactgatgatgt |
43815351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University